Table 2

Primers for RT-PCR

Protein & Gene

Accession #

Forward Primer (5'→3')

Reverse Primer (5'→3')

Product bp

Anneal °C


Gα14

Gna14

NM_008137

attagctacttcccagagtacaca

gctcagatcaccctctgtct

256

62°C


* tcatgcaacagagggacttg

* agggccatgctcaattacac

294

60°C


Gαq

Gnaq

NM_008139

gtcgactacttcccagaatatgat

agtccaggacggcaataaat

333

62°C


* aacacacaccatccgtcaga

* ggcaagcagtggtctctagc

229

60°C


Gα11

Gna11

NM_010301

agcccaagtcctgagtttga

tgccaagtcagagtggagaa

236

60°C


Gαgus

Gnat3

NM_001081143

gcaaccacctccattgttct

agaagagcccacagtctttgag

286

58°C


PLCβ2

Plcb2

NM_177568

gagcaaatcgccaagatgat

ccttgtctgtggtgaccttg

163

60°C


SNAP25

Snap25

NM_011428

ggcaataatcaggatggagtag

agatttaaccacttcccagca

310

58°C


T1R2

Tas1r2

NM_031873

aagcatcgcctcctactcc

ggctggcaactcttagaacac

114

58°C


T1R3

Tas1r3

NM_031872

gaagcatccagatgacttca

gggaacagaaggacactgag

283

58°C


TrpM5

Trpm5

NM_020277

gtctggaatcacaggccaac

gttgatgtgccccaaaaact

234

58°C


β-actin

Actb

NM_007393

ccctgtgctgctcacc

gcacgatttccctctcag

328

58°C


Primers marked * (Gα14 and Gαq) are located closer to the mRNA 3' end and were only used on amplified RNA from pools of GFP-expressing cells (Fig. 2).

Tizzano et al. BMC Neuroscience 2008 9:110   doi:10.1186/1471-2202-9-110

Open Data