Table 1

Primer sequences and cycling conditions in RT-PCR

Lenght of amplified

Primer sequences

Cycles


Nestin

220 bp

5'GCCCTGACCACTCCAGTTTA3'

5'GGAGTCCTGGATTTCCTTCC3'

33 cycles:

30 sec, 94°C

30 sec, 55°C

30 sec, 72°C

Vimentin

200 bp

5'GGGACCTCTACGAGGAGGAG3'

5'CGCATTGTCAACATCCTGTC3'

30 cycles:

30 sec, 94°C

30 sec, 55°C

30 sec, 72°C

NF-M

333 bp

5'TGGGAAATGGCTCGTCATTT3'

5'CTTCATGGAAGCGGCCACTT3'

35 cycles:

30 sec, 94°C

60 sec, 55°C

90 sec, 72°C

NSE

329 bp

5'TGAACACAGACGCTATGCGCTCAG3'

5'CACCTTTATGTGAGTGGACACAGA3'

30 cycles:

60 sec, 94°C

60 sec, 60°C

120 sec, 72°C

Hes1

349 bp

5'ACACGACACCGGATAAACCAA3'

5'CGAGTGCGCACCTCGGTA3'

25 cycles

30 sec, 94 °C

30 sec, 60 °C

30 sec, 72 °C

GAPDH

347 bp

5'GCCAAAAGGGTCATCATCTCTG3'

5'CATGCCAGTGAGCTTCCCGT3'

25 cycles:

30 sec, 96°C

60 sec, 58°C

30 sec, 74°C


Scintu et al. BMC Neuroscience 2006 7:14   doi:10.1186/1471-2202-7-14

Open Data