Table 1

Forward and reverse primers used for PCR amplification

Gene

Primers (5'→3')

Nucleotides

Size(bp)


GDNF

atgggatgtcgtggctgtctg

58–98

643

tctctggagccagggtcagat

700–680

BDNF

ggatgaggaccagaaggttgc

2342–2362

390

ttgtctatgcccctgcagcct

2731-2711

NGF

gcagacccgcaacatcactgt

484–504

517

agccttcctgctgagcacaca

1000-980

Nestin

aggaaccaaaagagacaggtg

4141–4161

653

ttcctcagatgagaggtcaga

4793-4773

GFAP

cctcaagaggaacatcgtggt

1119–1139

592

acactggagtcatcacctgga

1710-1690

β-Tubulin III

tagtggagaacacagacgaga

600–620

442

ctgctgttcttactctggatg

1041-1021

MT1

tgagtgtcatcggctcgatat

1–21

397

tagtaactagccacgaacagc

397-377

MT2

tgctgcatctgtcatagtacc

4–24

297

acatggttaggaaactgcgca

346-326

GAPDH

ttcaccaccatggagaaggc

1147–1166

237

ggcatggactgtggtcatga

1383-1364


Niles et al. BMC Neuroscience 2004 5:41   doi:10.1186/1471-2202-5-41

Open Data