Table 1

List of specific primers
Gene Sequence Size(bp) To Accession N.
Palmdelphin F: 5′- ATTCTCTTCCTCTCTCCCTGCTGC -3′ 102 55 NM_023245.3
R: 5′- GCTACCATAAATCAAGGTGCGTCC-3′
Rab27 F: 5′- AGCCAGCAGAAAAGAAATGTGC-3′ 155 55 NM_001082553.1
R: 5′- ATTGGGGTCAGGGGAGAAAGAC-3′
Tyrosinase F:5′-CTGTGCCTCCTCTAAGAACTTGTTG-3′ 163 57 NM_011661.4
R:5′-ACGGTCATCCACCCCTTTGAAG-3′
Ki67 F:5′CCAGAGCTAACTTGCGCTGAC-3′ 148 54 NM_001081117.2
R:5′GCTTGATGGTGACCAGGTGAG-3′
Cyclin D1 F:5′-ACCCTGACACCAATCTCCTCAAC-3′ 118 56 NM_171992
R:5′-ATGGATGGCACAATCTCCCTCTGC-3′
Otx2 F:5′-TCTGGTCTCACTCCATCCCC-3′ 172 51 NM_144841.3
R:5′-TGGTTTACTGCTTCGGAGGG-3′
Lhx2 F:5′-GAGACGTGCAGGCATCTGG-3′ 133 55 NM_010710.3
R:5′-CATCGCTAGCTGGGTTCTGG-3′
Pax6 F:5′-CACCAGACTCACCTGACACC-3′ 193 54 NM_001244198.1
R:5′-TCACTCCGCTGTGACTGTTC-3′
Rx F:5′-ATCCCAAGGAGCAAGGAGAG-3′ 256 58 AF135839
R:5′-TTCTGGAACCACACCTGGAC-3′
β-III Tubulin F:5′-TTTTCGTCTCTAGCCGCGTG-3′ 157 54 NM_023279.2
R:5′-CTGCAGGTCTGAGTCCCCTA-3′
Map2 F:5′-ATTAACCAACCACTGCCGGA-3′ 188 52 NM_001039934.1
R:5′-ATTTGTACATTTCCGCCCCC-3′
Nav 1.1 F:5′- CATACATCTTTCGGGGGAATCTC-3′ 195 54 NM_018733.2
R:5′- CATCTTTTTTGTCTGGCTTGGG-3′
Nav 1.7 F:5′- GAAGACCCCGAAGAAGAAGAAGG-3′ 194 54 NM_009135.2
R:5′-GCATTGAACCTGAAGATGACTCTGC-3′
Kv 1.3 F: 5′- CGAGCGTGTGGTCATCAACATC-3′ 128 58 NM_008418.2
R: 5′- CATTGCGGAGTGGGTCAAAG-3′
Kv 1.5 F: 5′- CATCAAGGAAGAGGAGAAGCCC -3′ 127 56 NM_145983.2
R: 5′- GAGAATGACCAAGACCGACACG -3′
Ath5 F:5′- CAGGACAAGAAGCTGTCCAA-3′ 173 56 AF071223
R:5′- GGGTCTACCTGGAGCCTAGC-3′
Brn3b F:5′-AGACTTCGAGCAGGAGATG-3′ 322 60 NM_138944.2
R:5′-CTTGATCTTCATGGTGCTAGG-3′
Isl1 F:5′- TTCTCCGGATTTGGAGTGGC-3′ 188 53 NM_021459.4
R:5′- CACGCATCACGAAGTCGTTC -3′
Thy1 F:5′- ACCAAGCCAGATGCCTGAAA -3′ 147 54 NM_009382.3
R:5′- GGATGGTCCACAAAGGCTCA-3′
Sncg1 F:5′-AAGAGGCAGTAGCAGCAGAGACAG-3′ 131 56 NM_011430.3
R: 5′- CAACACCTTCCTTGGCAATGG-3′
Rpf1 F:5′- AGTTACTAATGCACAAGGACA-3′ 380 57 NM_010127.3
R:5′-CTCAAAGCTGAAGAAGAGGAG-3′
Crx F:5′-CCTGTAAAAGAACTGACAAGAGGGG-3′ 153 55 NM_001113330.1
R:5′- AAGGCATTGACTGAATAGTGAGGC-3′
Nrl F:5′-TTCTGTCTCATCTTCCAGGCTGTAG-3′ 120 50 NM_001136074
R:5′-ACAACTTCTTCTCCCCCTTCCTC-3′
Nr2e3 F:5′-CCGAAACTTGTGCTAAACTGGAGC-3′ 183 56 NM_013708.4
R: 5′- GGAAAGGCAGGTTGGAAAACAC-3′
RK F:5′-GCTGAACAAGAAGCGGCTGAAG-3′ 238 56 NM_011881
R:5′-TGCTGTGTAGTAGATGGCTCGTGG-3′
Rhodopsin F:5′-TCAAGCCTGAGGTCAACAAGC-3′ 422 62 BC013125
R:5′-ACTTCCTTCTCTGCCTTCTGAGTG-3′
Gnat1 F:5′- AGATGAAGATTATCCACCAGGACG-3′ 136 55 NM_008140.2
R:5′- TCTCCATACTGAATGTTGAGCGTG-3′
Phosducin F:5′-TGCTGTGGATGTGGAGTCTTTCC-3′ 105 51 NM_001159730.1
R:5′-GCTTATTCAATGTCCTCGTCTTCC-3′
Recoverin F:5′-GGAAAAGAAACAGTGATGGGCAC-3′ 188 57 NM_009038.2
R:5′-AAAAGGAAGCAGGAGTTGTGTCC-3′
Rod Arrestin F:5′-TGTCCTCACCCAACTCCAAGAGAG-3′ 153 56 NM_009118.2
R:5′-ACCTCAAAGTCAACCCCACAGC-3′
GAPDH F: 5′-ACAGTCCATGCCATCACTGCC -3′ 266 60 NM_017008.3
R: 5′-GCCTGCTTCACCACCTTCTTG-3′

Del Debbio et al.

Del Debbio et al. BMC Neuroscience 2013 14:130   doi:10.1186/1471-2202-14-130

Open Data