Table 3

Primers used for validation of stress-responsive genes by RT-qPCR
Gene ID Symbol Sense (5-3) Antisense (5-3) Amplicon size (bp)
18S ribosomal RNA Rn18s CCCGAAGCGTTTACTTTGAA CCCTCTTAATCATGGCCTCA 136
Glyceraldehyde-3-phosphate dehydrogenase Gapdh GAAGGGCTCATGACCACAGT GGATGCAGGGATGATGTTCT 117
Actin, beta Actb CACACTGTGCCCATCTATGA CCGATCGTGATGACCTGACC 272
Calcium/calmodulin-dependent protein kinase II alpha Camk2a GCCTGGACTTTCATCGATTC GGTACTGAGTGATGCGGATGT 141
Glycogen synthase kinase 3 beta Gsk3β GCGAGACACACCTGCCCTCTTC GTGGCCAGAGGTGGGTTACTTGAC 66
Mammalian target of rapamycin (serine/threonine kinase) mTOR TTGGATGTTCCAACCCAAGT CAGGCCTTGGTTACCAGAAA 106
Neurotrophic tyrosine kinase, receptor, type 2 Ntrk2 TGGAGGGCGACCCACTCATCA TCAGCTCGG TGGGCGGGTTA 123
Neurotrophic tyrosine kinase, receptor, type 3 Ntrk3 CATCCGCTGGATGCCACCTGAAA AAGACACGGCCTTGGGTGATGCA 50
Phosphoinositide-3-kinase, catalytic, beta polypeptide Pik3cb CCTGCGACAGATGAGTGATG CAATCCTCCGGTTGTCAAGT 134
V-raf murine sarcoma viral oncogene homolog B1 Braf CATGGCGACGTGGCAGTGAAAATG TGAGGTGTGGGTGCTGTCACATTC 50
Glyceraldehyde-3-phosphate dehydrogenase-3-prime Gapdh-3 GGCTGGCATTGCTCTCAA GAGGTCCACCACCCTGTTG 88
Glyceraldehyde-3-phosphate dehydrogenase-5-prime Gapdh-5 GACAGCCGCATCTTCTTG CACCGACCTTCACCATCTTG 63
Actin, beta-3-prime Actb-3 CCTAGCACCATGAAGATCAAGA GCCAGGATAGAGCCACCAATC 77
Actin, beta-5-prime Actb-5 ACCCAGATCATGTTTGAGACCTT CAGAGGCATACAGGGACAAC 79

Barreto et al.

Barreto et al. BMC Neuroscience 2012 13:125   doi:10.1186/1471-2202-13-125

Open Data