Table 2 |
|||||
|
PCR primers for quantitative chromatin immunoprecipitation assays |
|||||
|
Gene |
ChIP Antibody |
Positions† |
Sense primer |
Anti sense primer |
bp |
|
|
|||||
|
Rho |
Pol-II-S2 |
+3051 to +3199 |
ggagatcccatgcacaaagt |
taagctccctgccacttgac |
149 |
|
|
|||||
|
Rho |
FIZ1 |
-711 to -570 |
cagcaggccagtaggatca |
gaggaggggcgtaagaagtt |
141 |
|
|
|||||
|
Rho |
FIZ1 |
-12 to +130 |
cccctctgcaagccaatta |
gcaactccaggcactgac |
142 |
|
|
|||||
|
Untr6 |
Pol-II-S2 FIZ1 |
4.4 × 106 bp downstream of Rho |
tcaggcatgaaccaccatac |
aacatccacacgtccagtga |
216 |
|
|
|||||
|
†Relative to the transcriptional start site (+1). Rho (Rhodopsin), Untr6 (untranslated region Chromosome-6), Pol-II-S2 |
|||||
|
Mali et al. BMC Molecular Biology 2008 9:87 doi:10.1186/1471-2199-9-87 |
|||||