Table 2

PCR primers for quantitative chromatin immunoprecipitation assays

Gene

ChIP Antibody

Positions†

Sense primer

Anti sense primer

bp


Rho

Pol-II-S2

+3051 to +3199

ggagatcccatgcacaaagt

taagctccctgccacttgac

149


Rho

FIZ1

-711 to -570

cagcaggccagtaggatca

gaggaggggcgtaagaagtt

141


Rho

FIZ1

-12 to +130

cccctctgcaagccaatta

gcaactccaggcactgac

142


Untr6

Pol-II-S2 FIZ1

4.4 × 106 bp downstream of Rho

tcaggcatgaaccaccatac

aacatccacacgtccagtga

216


†Relative to the transcriptional start site (+1).

Rho (Rhodopsin), Untr6 (untranslated region Chromosome-6), Pol-II-S2

Mali et al. BMC Molecular Biology 2008 9:87   doi:10.1186/1471-2199-9-87

Open Data