Table 6

Primers and amplicons for each of the 10 HKGs and GmBFT

Name

Forward Primer Sequence [5'-3']

Reverse Primer Sequence [5'-3']

Amplicon Length (bp)

Primer locationa

E(%)

R2


ACT11

CGGTGGTTCTAT CTTGGCATC

GTCTTTCGCTTCAA TAACCCTA

142

D

98.04

0.9979

ACT2/7

CTTCCCTCAGCA CCTTCCAA

GGTCCAGCTTTCA CACTCCAT

119

D

109.56

0.9979

G6PD

ACTCCTTGATAC CGTTGTCCAT

GTTTGTTATCCGCC TACAGCCT

126

D

98.59

0.9990

ELF1B

GTTGAAAAGCCA GGGGACA

TCTTACCCCTTGA GCGTGG

118

D

93.15

0.9883

UBC2

TCCCCTCACACC CTTCCTC

CCATCCCAAGGGG TGTCAT

155

D

100.60

0.9988

CYP2

CGGGACCAGTGTGCTTCTTCA

CCCCTCCACTACAAAGGCTCG

154

S

82.31

0.9848

ELF1A

GACCTTCTTCGT TTCTCGCA

CGAACCTCTCAAT CACACGC

195

D

98.21

0.9981

TUB

CCTCGTTCGAAT TCGCTTTTTG

CAACTGTCTTGTC GCTTGGCAT

161

S

100.84

0.9956

TUA

AGGTCGGAAACT CCTGCTGG

AAGGTGTTGAAGG CGTCGTG

159

S

85.75

0.9829

UBQ10

CGCCTCTAATCT CGCAGTTCC

GTTGTCAATGGTG TCGGAGGA

114

S

120.28

0.9663

GmBFT

CCAAGGGAAATT GTGAGGTA

CTACTAAAAAGCC CCACAGC

191

S

101.65

0.9985


aD, the two primers were located on different exons; S, the two primers were located on the same exon.

Jian et al. BMC Molecular Biology 2008 9:59   doi:10.1186/1471-2199-9-59

Open Data