Table 1

Oligonucleotides used for this study

Primers used for the generation of TLR2 promoter/reporter constructs


pGL3-T2P(-309)

5'-GCCTCTAGCGTCTCGATTCGC-3'

5'-CTGGGAGAACTCCGAGCAGTC-3'

pGL3-T2P(-194)

5'-CTGTCGCAGCCTAGCTCACGG-3'

5'-CTGGGAGAACTCCGAGCAGTC-3'

pGL3-T2P(-120)

5'-CCTGCCTGGAACTCAGCGCG-3'

5'-CTGGGAGAACTCCGAGCAGTC-3'

pGL3-T2P(-60)

5'-TGCCCCGTGGAAGGGGCGGTT-3'

5'-CTGGGAGAACTCCGAGCAGTC-3'

pGL3-T2P(-12)

5'-CGCGCGGACTTTCCCTTTTGC-3'

5'-CTGGGAGAACTCCGAGCAGTC-3'


Primers used for the generation of mutant TLR2 promoter/reporter constructsa


pGL3-T2P(-120) SPm

5'-CCCGTGGAAGGTTAGGTTCCCGCACCCCAG-3'

5'-CTGGGGTGCGGGAACCTAACCTTCCACGGG-3'

pGL3-T2P(-120)/(-60) ETSm

5'-GCGCACGTGCCCCGACGAAGGGGCGGTTCC-3'

5'-GGAACCGCCCCTTCGTCGGGGCACGTGCGC-3'


Primers used for semi-quantitative RT-PCR


SP1

5'-TGTGAATGCTGCTCAACTCTCC-3'

5'- CATGTATTCCATCACCACCAG -3'

SP3

5'-AACCTGATCCTGAAGAGTGGC-3'

5'-TGGCGGAAGTATTAACAGTTCC-3'


Oligonucleotides used for EMSAb


T2P(-64/-31)

5'-GTGCCCCGTGGAA

    GGGGCGG
TTCCCGCACCCCAG-3'

5'-CTGGGGTGCGGGAA

    CCGCCCC
TTCCACGGGGCAC-3'

T2P(-64/-31) SPm

5'-GTGCCCCGTGGAA

    GGTTAGG
TTCCCGCACCCCAG-3'

5'-CTGGGGTGCGGGAA

    CCTAACC
TTCCACGGGGCAC-3'

T2P(-64/-31)-monoMe

5'-GTGCCCCGTGGAA

    GGGGCGG
TTCCCGCACCCCAG-3'

5'-CTGGGGTGCGGGAA

    C/M-C/GCCCC
TTCCACGGGGCAC-3'

T2P(-64/-31)-triMe

5'-GTGCCCCGTGGAA

    GGGGCGG
TTCCCGCACCCCAG-3'

5'-CTGGGGTG/M-C/GGGAA

    C/M-C/GCCCC
TTCCA/M-C/GGGGCAC-3'


a Mutations introduced in the oligonucleotides are shown in italic.

b Putative SP1 binding sequences are underlined. Mutations introduced in the oligonucleotides are shown in italic. M-C represents methylated cytosine.

Furuta et al. BMC Molecular Biology 2008 9:39   doi:10.1186/1471-2199-9-39

Open Data