Table 3

Sequences of fluorescence hybridization probes

Gene name

Sequence


TRBC

ACGAGTGGACCCAGGATAGGGCCAA

TRBV common probe

CACCCGAGGTCGCT

HPRT-CCM

TTTCACCAGCAAGCTTGCGACCTTGA

IL10

TTACAGGACCAGAGGGACAAGACATGACTGTG

IFNγ

TTTCTGTCACTCTCCTCTTTCCAATTCTTCAAA

TGFβ

CACGCAGTACAGCAAGGTCCTGGCC

FoxP3

AGCCGGGAGAGTTTCTCAAGCACTGC

T-bet

CACCTGTTGTGGTCCAAGTTTAATCAGCACC

GATA3

TCCTGTGCGAACTGTCAGACCACCAC

GRAIL

GGAAGGCTTCAACTACGCACACTGAAACAAG

Granzyme A

CTTCCAGAATCTCCAATTGCGCGAGTCTCTTC

Granzyme B

CCCACGCACAACTCAATGGTACTGTCG

Granulysin

ACCCAGAGAAGTGTTTCCAATGCTGCGAC

Perforin

TGCCGCTTCTACAGTTTCCATGTGGTACAC


Sequences of fluorescence hybridization probes of self-designed real-time RT-PCR gene assays. For the different TRBV forward primers, one common MGB hybridization probe was used.

Noutsias et al. BMC Molecular Biology 2008 9:3   doi:10.1186/1471-2199-9-3

Open Data