Table 1

PCR primers for the amplification of reference gene candidate genes, designed with the software Primer Express 2.0 (Applied Biosystems).

Reference gene

Orientation

5'- 3' Sequence

Bp

Tm (°C)


Beta-Actin

actb

For

GCGTGGCTACTCCTTCACC

19

57

Rev

AGGACTTCATACCGAGGAAGG

21

56

Eucaryotic elongation Factor 1 alpha

eef1a

For

CCACCGTTGCCTTTGTCC

18

58

Rev

TGGGACTGTTCCAATACCTCC

21

57

Hypoxanthine phosphoribosyltransferase 1

hprt1

For

GACGCAGATATGGTTCAGATCTC

23

57

Rev

GTCTTGATTGTGGAGGATATTATCG

25

57

L13A ribosomal binding protein

rpl13a

For

CACCTTGGTCAACTTGAACAGTG

23

58

Rev

TCCCTCCGCCCTACGAC

17

58

RNA-Polymerase II

rpo2

For

TTAACAGGTGGGGGGTGC

18

58

Rev

AGCTCAAGAGCAGAAAGATCCC

22

58

TATA-Box binding protein

taf2

For

GGAGTTCATGTTGCAGGTTTTC

22

57

Rev

CGTTCCTCTTCCTATTGAAGGC

22

58

Ubiquitin

ubc

For

AGACGGGCATAGCACTTGC

19

58

Rev

CAGGACAAGGAAGGCATCC

19

57

Glyceraldehyd-3-phosphate dehydrogenase

gapd

For

TGGTCAGCTTACCGTTGAGC

20

58

Rev

CCCCCTGGCTAAAGTCATCC

20

59

Beta-2-microglobulin

b2m

For

AGACTATGCCTGGGAATCAAAC

22

56

Rev

GAAGATGTGTTGAATAGAAGCTGG

24

56

18S rRNA

18S rRNA

For

GACTCCGGTCCTATTTTGTGG

21

57

Rev

GCTAGTTGGCATCGTTTATGG

21

56

Glucose-6-phosphate dehydrogenase

g6pd

For

GGACGGTGTTCCTTTCATCC

20

58

Rev

TAGGTGAGGTCCAGCTCGG

20

57

Peptidylprolyl isomerase A

ppia

For

CCCCTGGCTGGACGG

15

58

Rev

TAAAAATGACGGGAGGGGG

19

58


Hibbeler et al. BMC Molecular Biology 2008 9:18   doi:10.1186/1471-2199-9-18

Open Data