Table 2

Oligonucleotides

Primer

Sequence


Sac1(-500)fwd

TT

    GCGGCCGC
ACAGCTACCACATCCCTGAC

Sac1(-242)fwd

TT

    GCGGCCGC
CCAAGCCTCGCTCCTATTGT

Sac1(-170)fwd

TT

    GCGGCCGC
CTGCACTACTGCTTACCCACA

Sac1(-125)fwd

TT

    GCGGCCGC
GAAGTTGAAAAGGCAAGGGA

Sac1(-114)fwd

TT

    GCGGCCGC
GGCAAGGGAAAAATACCACA

Sac1(-100)fwd

TT

    GCGGCCGC
ACCACAGGTTTAGATAAGGA

Sac1(-83)fwd

TT

    GCGGCCGC
GGAAATAGGAGAAAGGATTAG

Sac1(-1)rev

GG

    CTCGAG
ATCTAGACGAGAAAATATACG

Sac1(-150)rev

GG

    CTCGAG
TGTGGGTAAGCAGTAGTGCAG

Sac1Δ(-100/-84)fwd

GAAAAGGCAAGGGAAAAATGGAAATAGGAGAAAGG

Sac1Δ(-100/-84)rev

CCTTTCTCCTATTTCCATTTTTCCCTTGCCTTTTC

Sac1Δ(-83/-70)fwd

CCACAGGTTTAGATAAGGATTAGAAACCATATCC

Sac1Δ(-83/-70)rev

GGATATGGTTTCTAATCCTTATCTAAACCTGTGG

Sac1Δ(-91/-84)fwd

GGGAAAAATACCACAGGTGGAAATAGGAGAAAGG

Sac1Δ(-91/-84)rev

CCTTTCTCCTATTTCCACCTGTGGTATTTTTCCC

Sac1Δ(-100/-92)fwd

GGCAAGGGAAAAATATTAGATAAGGAAATAGG

Sac1Δ(-100/-92)rev

CCTATTTCCTTATCTAATATTTTTCCCTTGCC

Opi1KOfwd

CATATCAGGCCAGAACGTGGCATTTTGTTTACAGTGCTGAAGATTGTACTGCTGAGAGTGCAC

Opi1KOrev

AACTATATTATTCCGTATAATATTATTACTGGTGGTAATGCTGTGCGGTATTTCACACCG


Knödler et al. BMC Molecular Biology 2008 9:16   doi:10.1186/1471-2199-9-16

Open Data