Table 3

Primers used in the PCR experiments

Fish

Primer

Sequence primer (5'-3')


D. rerio

DAG1_s

CCAGCCTTTCATCTGTGGCAA

D. rerio

DAG1_as

CTTCGCACCCTTTTGGGCAC

D. rerio

ACT_s

TCTTGACCCTGAAGTACCCCATT

D. rerio

ACT_as

TCCTTGATGTCGCGCACAAT

D. labrax

FISH_ext_s

GGGCTTCAGCACATGAAGAT

D. labrax

FISH_ext_as

CTGTAGGG(A/G)GTCATGTTCTT

D. labrax

ACT s

TCCTGACCCTGAAGTACCCCA

D. labrax

ACT as

TTGATGTCACGCACGATTTCC

T. nigroviridis

DAG1a s

CAGACGTTCCTGTGTGAGGGG

T. nigroviridis

DAG1a as

GCTTCGGAAGGTGCTGCTTC

T. nigroviridis

DAG1b s

AGCTCAGCCTCTCACCTGTAGC

T. nigroviridis

DAG1b as

GACTCGTTTCACTCCATGGACC

T. nigroviridis

ACT s

CACCCTGAAGTATCCCATCGAA

T. nigroviridis

ACT as

GTCTCTGACGATCTCTCGCTCAG


The primers used to amplify the gene sequences from D. rerio and T. nigroviridis were designed using the sequences available in the database. The degenerate primers FISH_ext_s and FISH_ext_as, which allowed the fishing of the newly identified D. labrax sequence, were chosen exploiting two regions displaying very high homology within the aligned DG sequences from D. rerio and T. rubripes (see also Fig. 1).

Pavoni et al. BMC Molecular Biology 2007 8:34   doi:10.1186/1471-2199-8-34

Open Data