Open Access Open Badges Research article

Interleukin-4 inhibition of interleukin-1-induced expression of matrix metalloproteinase-3 (MMP-3) is independent of lipoxygenase and PPARγ activation in human gingival fibroblasts

Denise Stewart, Masoud Javadi, Mariah Chambers, Chad Gunsolly, Grzegorz Gorski and Ruth C Borghaei*

Author Affiliations

Department of Biochemistry and Molecular Biology, Philadelphia College of Osteopathic Medicine, Philadelphia, PA, USA

For all author emails, please log on.

BMC Molecular Biology 2007, 8:12  doi:10.1186/1471-2199-8-12

The electronic version of this article is the complete one and can be found online at:

Received:26 July 2006
Accepted:23 February 2007
Published:23 February 2007

© 2007 Stewart et al; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.



Interleukin 4 (IL-4) has been shown to suppress interleukin-1 (IL-1) induced expression of matrix metalloproteinase-3 (MMP-3) in human synovial and gingival fibroblasts, but the mechanism of suppression has not been determined. Activators of peroxisome proliferator-activated receptor-γ (PPARγ) have been shown to inhibit cytokine induced expression of MMPs in other cell types, and IL-4 has been shown to activate PPARγ by stimulating production of ligands through the lipoxygenase pathway. It has been suggested that PPARγ may inhibit expression of MMPs by competing with transcription factor AP-1 for binding to a putative composite binding element in the promoters. The objective of this study was to determine whether the suppressive effects of IL-4 on the IL-1 induced expression of MMP-3 involve activation of lipoxygenase and/or PPARγ.


Western blotting revealed the presence of PPARγ in nuclear extract of HGF. IL-1 induced binding of nuclear extract to the putative composite PPRE/AP-1 site was diminished in the presence of pioglitazone, but there was no evidence of any change in the composition of the retarded complexes, and no evidence of PPARγ binding to this site. Nordihydroguaiaretic acid (NDGA), a non-selective lipoxygenase inhibitor, and MK886, a specific inhibitor of 5-lipoxygenase, induced MMP-3 expression synergistically with IL-1. However IL-4 was still able to inhibit MMP-3 expression in the presence of NDGA or MK886 and IL-1. Activation of PPARγ with pioglitazone not only failed to inhibit IL-1 induced expression of MMP-3 mRNA, but rather super-induced MMP-3 in the presence of IL-1. PPARγ antagonist GW9662 failed to abolish the suppressive effects of IL-4. Another PPARγ activator, 15-deoxy-Delta12,14prostaglandin J2 (15dPGJ2), also super-induced MMP-3 mRNA, and this was due at least in part to increased transcription.


IL-4 suppression of IL-1-induced MMP-3 expression in HGF is independent of lipoxygenase activity and activation of PPARγ. Super-induction of MMP-3 by pioglitazone may have important implications for patients using pioglitazone to treat type II diabetes in the presence of chronic inflammation.


MMP-3 (stromelysin-1) is a metalloproteinase with broad substrate specificity, degrading proteoglycan, laminin, fibronectin, and the non-fibrillar collagens [1]. Perhaps equally important, it is also capable of activating other pro-MMP's, including MMP-1, -8, -9 and -13 [2-4], of inactivating plasminogen activator inhibitor I [5], and of cleaving E-cadherin [6] and FasL [7]. MMP-3 is produced by gingival and synovial fibroblasts, chondrocytes, macrophages, neutrophils, and endothelial cells in response to inflammatory cytokines and mitogens. In periodontitis, MMP-3 is present at increased levels in active disease sites compared to inactive or healthy sites [8-11], and the levels are correlated with clinical parameters and associated with progression of the disease [11]. A similar situation exists in rheumatoid arthritis [12]. Studies of the effects of a promoter polymorphism that affects protein expression has shown that individuals with the high expressing 5A/5A genotype are at increased risk for aneurysms and myocardial infarctions [13-15], while those with the lower expressing 6A/6A genotype show a faster progression of atherosclerosis [15,16]. Taken together, these studies suggest that regulation of MMP-3 levels is important for the maintenance of health, and that either too much or too little can have detrimental effects.

Chronic inflammation in rheumatoid arthritis and periodontitis is characterized by increased levels of IL-1β, TNFα and prostaglandin E2 (PGE2), which contribute to destruction of joints and alveolar bone in part through increased production of matrix metalloproteinases (MMPs) [17-20]. In addition, there is a relative absence of IL-4-producing T cells at sites of inflammation [12,21-25]. This imbalance is progressive, with decreasing levels of IL-4 correlated with loss of collagen and with increasing clinical severity [26]. In addition, polymorphisms in the IL-4 promoter and intron that are associated with decreased serum levels of IL-4 are also associated with increased susceptibility to early onset periodontitis [27]. It has been suggested that correcting this cytokine imbalance in chronic inflammatory conditions might be therapeutic. In fact, adenoviral transfer of IL-4 has been shown to be protective against cartilage degradation induced by injection of rheumatoid arthritis synovial tissue into joints of SCID mice [28] and against collagen-induced arthritis [29].

IL-4 has been shown to inhibit the IL-1 induction of MMP-3 expression in human conjunctival fibroblasts [30], skin fibroblasts [31] and articular chondrocytes [32,33], as well as in synovial fibroblast cultures established from patients with osteoarthritis [34] and gingival fibroblast (HGF) cultures established from patients with periodontitis [35]. The mechanism of the inhibition of MMP-3 by IL-4 in HGF was not determined, although PGE2 was not involved, and DNA binding of transcription factors AP-1 and NF-κB to their consensus sequences was not inhibited [35].

Peroxisome proliferator-activated receptor-γ (PPARγ) is a member of the nuclear receptor super-family. It plays an important role in adipogenesis and insulin sensitization and has also been shown to have a number of anti-inflammatory effects [36]. IL-4 has been shown to activate PPARγ in macrophages by increasing the activity of 15-lipoxygenase, leading to increased production of ligands [37-39]. PPARγ ligands and agonists have been shown to inhibit production of MMP-3 [40,41], and to prevent MMP-mediated tissue destruction in animal models of inflammation, including arthritis [42,43] and periodontitis [44].

A recent study by Francois, et al. [45] identified a composite element in the rabbit MMP-1 promoter that exhibited mutually exclusive binding of PPARγ or AP-1 and was responsible for reduced gene expression in the presence of PPARγ agonist rosiglitazone in chondrocytes. The authors reported that computer-based analysis of the human MMP-1 and MMP-3 promoter sequences revealed similar putative composite elements overlapping the well-studied AP-1 sites in each gene. The present study was undertaken to determine whether there is a functional composite PPRE/AP-1 site in the MMP-3 promoter, and if so, whether it is involved in IL-4 suppression of IL-1 induced expression of MMP-3 in HGF. Results show that there is no binding of PPARγ to this site in HGF, and that the suppressive effects of IL-4 are independent of lipoxygenase activity and PPARγ. Surprisingly, a 5-lipoxygenase inhibitor and a PPARγ activator both super-induce MMP-3 in the presence of IL-1.


PPAR-γ is present in HGF nuclear extract

PPARγ is present in the cytosol until ligand binding, at which point it forms heterodimers with retinoid X receptor (RXR) and migrates to the nucleus. In order to demonstrate the presence of PPARγ in HGF, nuclear extract were isolated from control cultures and from HGF cultures treated for 24 hours in the presence of IL-1 (10 ng/ml) and/or IL-4 (10 ng/ml). Results (Figure 1) showed that PPARγ is present in the nucleus of cytokine-stimulated HGF.

thumbnailFigure 1. PPARγ is present in HGF nuclear extract. Fifteen μg nuclear extract isolated from untreated HGF and HGF treated for 24 hour with IL-1 (10 ng/ml), IL-4 (10 ng/ml), or IL-1 and IL-4 were separated on 10% SDS-PAGE, and transferred to nylon membrane. Proteins were detected with anti-PPAR-γ antibodies followed by chemiluminescence. C = control, no cytokines.

Pioglitazone and IL-4 reduce AP-1 binding to the putative PPRE/AP-1 site, but do not change the composition of the complexes

Previous studies have shown that IL-4 inhibition of IL-1 induced expression of MMP-3 is not associated with any alteration in AP-1 binding. However, those studies were done with an AP-1 consensus probe or a probe containing only the AP-1 site from the MMP-3 promoter, neither of which would have encompassed the putative composite PPRE/AP-1 site proposed by Francois et al. [45]. In order to determine whether the composite site is functional in HGF, and whether it is involved in the ability of IL-4 to suppress MMP-3 expression, gelshift assays were performed using an oligonucleotide probe containing the putative composite site. As shown in Figure 2A, IL-1 induced binding to this site was diminished slightly in the presence of IL-4 or pioglitazone. However, neither pioglitazone nor IL-4 alone altered binding patterns compared to control – there were no additional bands or alterations in migration to suggest binding of alternative proteins. PPARγ anti-sera failed to shift the complex, and the ability of anti-sera directed against members of the AP-1 family to super-shift the complex was unchanged in the presence of IL-4 or pioglitazone (Figure 2B). In addition, an oligonucleotide probe corresponding to the consensus PPAR binding site failed to compete for binding to the PPRE/AP-1 probe (data not shown).

thumbnailFigure 2. There is no qualitative change in binding to the PPRE/AP-1 site in the presence of IL-4 or pioglitazone. A) HGF were incubated in the presence of IL-1 (10 ng/ml), IL-4 (10 ng/ml), and/or pioglitazone (1 μM) as indicated for 1 hour. Five μg nuclear extract were incubated with a 32P-labeled oligodeoxynucleotide probe containing the putative composite PPRE/AP-1 site from the MMP-3 promoter. P = probe alone, no extract; C = control, no cytokines. B) HFG were incubated in the presence of IL-1 (10 ng/ml) or IL-4 (10 ng/ml for 1 hour. Five μg nuclear extract were incubated with the PPRE/AP-1 site probe in the presence of the indicated antibodies. P = probe, no extract.

Inhibition of lipoxygenase fails to inhibit MMP-3 expression

In order to determine whether the ability of IL-4 to inhibit IL-1 induced expression of MMP-3 was linked with its ability to induce and/or activate lipoxygenase enzymes, a non-specific lipoxygenase inhibitor, NDGA, was added to the cultures. As shown in Figure 3A, addition of NDGA did result in a dose dependent increase in MMP-3 mRNA in the presence of IL-1 plus IL-4. However, NDGA alone increased MMP-3 expression relative to control. NDGA also resulted in a further induction of MMP-3 in the presence of IL-1. Importantly, IL-4 was still able to inhibit MMP-3 expression induced by IL-1 plus NDGA. Previous results [35] showed that IL-4 fails to inhibit IL-1 induced expression of MMP-1 in HGF. Those results are confirmed here (Figure 3B). IL-4 increased MMP-1 expression compared to control, and there was no significant difference between IL-1 alone and IL-1 plus IL-4. NDGA had no significant effect in the presence of IL-1 and/or IL-4, although it did increase the basal levels of MMP-1 similarly to MMP-3.

thumbnailFigure 3. IL-4 suppression of MMP-3 is independent of lipoxygenase activity, but inhibition of lipoxygenase super-induces MMP mRNA. HGF cultures were pre-treated with NDGA at the indicated doses for 1 hour prior to addition of IL-1 (10 ng/ml) and/or IL-4 (10 ng/ml). Total RNA was harvested 12 hours after cytokine treatment, quantitated by real-time PCR and normalized to levels of GAPDH. A) MMP-3. The graph represents data from seven independent experiments performed in triplicate, expressed as mean +/- SEM. B) MMP-1. The graph represents five independent experiments performed in triplicate, expressed as mean +/- SEM. Statistical significance was determined using Student's t-test.

Similar results were seen with a specific inhibitor of 5-lipoxygenase, MK886, which also increased MMP-3 protein levels (Figure 4). Again, IL-4 was still able to inhibit MMP-3 mRNA induced by IL-1 + MK886. The induction appears to occur at least in part at the transcriptional level, since MK886 increased transcription of an MMP-3 promoter construct in transiently transfected COS cells (Figure 4C).

thumbnailFigure 4. A specific inhibitor of 5-lipoxygenase, MK886, super-induces MMP-3 mRNA and protein. HGF cultures were pre-treated with NDGA at the indicated doses for 1 hour prior to addition of IL-1 (10 ng/ml) and/or IL-4 (10 ng/ml). A) Total RNA was harvested 12 hours after cytokine treatment, quantitated by real-time PCR and normalized to levels of GAPDH mRNA. The graph represents five independent experiments performed in triplicate, expressed as mean +/- SEM. B) Conditioned medium was collected from cultures after 24 hours incubation with cytokines +/- MK886 at the indicated doses. MMP-3 protein levels were determined by ELISA. The graph shows data from two different HGF cultures derived from two different donors. C) COS-1 cells were transiently transfected with a luciferase reporter construct containing 2300 bp of the human MMP-3 5' flanking sequence, along with an SV-β-gal reporter as a control for transfection efficiency. MK886 was added 16 hours after transfection, and cells were harvested 24 hours later. Shown are data from three independent experiments performed in triplicate, normalized to levels of β-galactosidase, and expressed relative to control, mean +/- SEM. Statistical significance was determined using Student's t-test.

Activation of PPARγ with Pioglitazone or 15dPGJ2 does not inhibit IL-1 induced expression of MMP-3 mRNA in HGF

The fact that IL-4 could still inhibit MMP-3 expression in the presence of NDGA suggested strongly that lipoxygenase activation is not involved in the inhibition, and the gelshift results demonstrate that there is no competition between PPARγ and AP-1 for binding to the promoter. However, it is possible that IL-4 could activate PPARγ through increased production of alternative ligands [39], and that activation of PPARγ might inhibit MMP-3 expression through another mechanism, such as competition for transcriptional co-activators [46,47]. In order to determine whether activation of PPARγ leads to suppression of MMP-3 expression in these cells, HGF cultures were pre-treated with increasing doses of the selective PPARγ agonist pioglitazone for one hour before addition of IL-1. Total RNA was harvested six hours later and analyzed by real-time PCR. Results of three independent experiments (Figure 5) showed that pioglitazone was not able to inhibit IL-1 induced expression of MMP-3. In fact, pioglitazone further increased MMP-3 mRNA in the presence of IL-1 (p = 0.025 at 1 μM and p = 0.060 at 10 μM). Likewise, another activator of PPARγ, 15dPGJ2 also seemed to super-induce MMP-3 mRNA expression in the presence of IL-1, although this did not reach statistical significance (Figure 6A). In transiently transfected COS cells, however, 15dPGJ2 cause a small but significant induction of transcription of an MMP-3 promoter construct (Figure 6B). In accordance with these findings, the ability of IL-4 to inhibit MMP-3 expression was not affected by the PPARγ antagonist, GW9662 (Figure 7).

thumbnailFigure 5. Pioglitazone fails to inhibit IL-1 induced MMP-3. HGF cultures were pre-treated with pioglitazone at the indicated doses for one hour before addition of IL-1 (10 ng/ml). Total RNA was isolated at 6 hours, quantitated by real-time PCR and normalized to levels of GAPDH. The graph represents data from three independent experiments performed in triplicate, mean +/- SEM. Statistical significance was determined by Students T-test, p = 0.025 at 1 μM, 0.06 at 10 μM vs IL-1 alone.

thumbnailFigure 6. PPARγ ligand 15dPGJ2 also induces MMP-3 transcription in COS-1 cells. A) HGF cultures were pre-treated with 15dPGJ2 at the indicated doses for one hour before addition of IL-1 (10 ng/ml) and/or IL-4 (10 ng/ml). Total RNA was isolated at 12 hours, quantitated by real-time PCR and normalized to levels of GAPDH. The graph represents data from six independent experiments performed in triplicate, mean +/- SEM. B) COS-1 cells were transiently transfected with a luciferase reporter construct containing 2300 bp of the human MMP-3 5' flanking sequence, along with an SV-β-gal reporter as a control for transfection efficiency. 15dPGJ2 was added 16 hours after transfection, and cells were harvested 24 hours later. Shown are data from three independent experiments performed in triplicate, normalized to levels of β-galactosidase, and expressed relative to control, mean +/- SEM. Statistical significance was determined using Student's t-test.

thumbnailFigure 7. PPAR antagonist GW9662 fails to reverse the inhibitory effects of IL-4. HGF cultures were pre-treated with GW9662 at the indicated doses for one hour before addition of IL-1 (10 ng/ml) and/or IL-4 (10 ng/ml). Total RNA was isolated at 12 hours, quantitated by real-time PCR and normalized to levels of GAPDH. The graph represents data from six independent experiments performed in triplicate, mean +/- SEM. Statistical significance was determined by Students T-test.


Results shown here demonstrate that there is no competition between PPARγ and AP-1 for binding to the MMP-3 promoter, and that IL-4 suppression of IL-1-induced expression of MMP-3 in HGF does not involve activation of lipoxygenase enzymes and/or PPARγ. However, the fact that inhibitors of lipoxygenase and an activator of PPARγ both resulted in super-induction of MMP-3 in the presence of IL-1 suggests that these factors may play a role in MMP-3 gene regulation.

Previous studies with the AP-1 site failed to detect any changes in DNA binding in cells treated with IL-1 plus IL-4 as compared to IL-1 alone [34,35]. Use of a larger probe containing the putative PPRE/AP-1 composite site did show decreased intensity of retarded bands in the presence of IL-4 (Figure 2). However there was no change in the migration of the retarded bands as one would expect if PPARγ were binding to the site in competition with AP-1, and a PPARγ specific antibody failed to supershift the bands. IL-4 has been reported to stimulate expression of JunB in peripheral blood monocytes from patients with atopic dermatitis [48]. Since JunB is less transcriptionally active than c-Jun [49,50], such a shift in the composition of AP-1 dimers would be expected to decrease transcription of at least some AP-1 dependent genes. Use of antisera against phosphorylated (active) c-Jun and Jun B suggest that IL-4 is not interfering with activation of c-Jun, nor is it changing AP-1 activity by causing the formation of less active dimers containing JunB. Taken together, these data demonstrate that IL-4 inhibition of MMP-3 expression cannot be explained by competition for binding to the AP-1 site or by changes in the composition of the AP-1 dimer.

Activation of PPARγ has been shown to inhibit cytokine stimulated gene expression in a number of ways, including inhibition of NF-κB and AP-1 activity through competition for limiting amounts of transcriptional coactivators [46,47]. Furthermore, IL-4 has been shown to activate PPARγ by stimulating the production of ligands through the lipoxygenase pathway [37-39] and in at least one case, through the production of alternative ligands [39].

The fact that IL-4 could still inhibit MMP-3 expression in the presence of NDGA or MK886 suggests that the mechanism of IL-4 inhibition does not require activation of lipoxygenase enzymes. Super-induction of IL-1 stimulated MMP-3 expression by NDGA was surprising in light of the fact that NDGA is known to inhibit AP-1 activity [51] and it has been shown to inhibit expression of MMP-3 in response to IL-17 [52]. Since pioglitazone also resulted in stimulation of MMP-3 expression while inhibiting AP-1 binding (Figures 2, 5), it is clear that other pathways are more important than AP-1 in this context.

As reported earlier [35], IL-4 failed to inhibit IL-1 induction of MMP-1. Although NDGA induced MMP-1 over control levels, it failed to super-induce MMP-1 with IL-1 as it did with MMP-3. These results represent another addition to a growing list of situations in which these two genes are not co-ordinately regulated. In one instance, Otani et al [53] showed induction of MMP-3, but not MMP-1 in the presence of cycloheximide. They suggested that cycloheximide might be inducing MMP-3 expression by preventing translation of a "labile repressor". It is interesting to note as well that the increased transcription of the MMP-3 promoter construct was observed only with the construct containing the 5A polymorphism and not in the construct containing the 6A polymorphism (data not shown). Since this polymorphic site has been shown to act as a repressor element in normal fibroblasts [16,54], it is tempting to speculate that these reagents are affecting the binding or activity of transcription factor(s) binding to this site in order to relieve the repression. Further experiments are needed to address these questions.

Interactions between the cyclooxygenase, lipoxygenase and PPAR pathways are overlapping and complex. Arachidonic acid is a common substrate for both cyclooxygenase and lipoxygenase enzymes. Expression of 15- and 5-lipoxygenase enzymes is often reciprocal [55,56]. Activation of PPARγ by troglitazone has been shown to inhibit expression of 5-lipoxygenase in rheumatoid arthritis synovial fibroblasts [57], lipoxygenase inhibitors can activate PPARγ in breast cancer cells [58] and COX-2 expression in macrophages has been postulated to be regulated by negative feedback mediated by PPARγ [59].

One potential explanation for the unexpected effects of NDGA and MK886, therefore, is that inhibition of lipoxygenase enzymes leads to an excess of arachidonic acid, which can then be converted to prostaglandins by cyclooxygenases. If pioglitazone and/or 15d PGJ2 caused a down-regulation of 5-lipoxygenase expression and/or activity, then they too could result in increased levels of arachidonic acid and increased production of prostaglandins.

This is not straight-forward however, since the effects of PGE2 on MMP-3 expression are variable, ranging from induction [60,61], to inhibition [62-64], to no effect [30,65]. A particularly interesting study by Rowanpura et al. [66], showed that the effects of PGE2 on IL-1 stimulated expression of MMP-3 differ in HGF derived from healthy tissue as opposed to HGF derived from patients with severe periodontitis. In HGF from healthy donors, PGE2 inhibited the IL-1 induction of MMP-3, whereas in diseased tissue, it resulted in further stimulation. This difference was shown to result from a change in PGE2 receptors, from EP2 and EP4 in healthy tissue to predominantly EP1 in diseased tissue.

Since our HGF were derived from patients with periodontitis, it is possible that addition of NDGA, MK886 and/or pioglitazxone resulted indirectly in increased production of PGE2, which caused super-induction of MMP-3 as described by Ruwanpura, et al. [66]. It is important to note that in previous studies using similarly derived HGF, addition of exogenous PGE2 failed to abrogate the suppressive effects of IL-4 on MMP-3 expression [35], but the effects of exogenous PGE2 alone or together with IL-1 were not tested. In the present study, there was some variation in the magnitude of responses, but the responses themselves were qualitatively consistent among cultures established from different individuals (n = 7 for NDGA, n = 5 for MK886, n = 3 for pioglitazone, n = 6 for 15d PGJ2 experiments).

Aside from demonstrating that PPARγ is not involved in the effects of IL-4 on MMP-3 expression, the failure of pioglitazone and 15dPGJ2 to inhibit MMP-3 expression (Figures 5 and 6) was surprising because other studies have shown inhibition of MMP-3 expression by activators of PPARγ [40,41]. The most obvious explanation for the super-induction would be the presence of a PPRE in the MMP-3 promoter. Computer analysis of the promoter sequence [Genomatix, [67]] failed to identify any PPRE. However, a recent study found that of the 73 known functional PPRE, only 2 conformed to the DR1 consensus, and 8% of them had 5 or more mismatches [68]. Therefore, this possibility cannot be excluded without further study.

The possibility of PPARγ-independent effects of pioglitazone and 15dPGJ2 also cannot be ruled out. 15dPGJ2 has been shown to have several effects independent of PPAR, including inhibition of NFκB [69]. Pioglitazone has been shown to up-regulate AMP-activated kinase in rat muscle and in NIH3T3 cells)[70] and to increase LPS stimulated production of PGE2 at high doses [71]. Aizawa et al. [72] showed that pioglitazone increased the IL-1 induced expression of inducible nitric oxide synthase (iNOS) in vascular smooth muscle cells (VSMCs) independent of PPARγ.

Both NDGA and pioglitazone have anti-oxidant properties which have been linked to their ability to inhibit the activity of redox sensitive transcription factor NF-κB [43,73,74]. NF-κB has been implicated in several studies to be involved in up-regulation of MMP-3 in inflammation [75-77], but more recent studies have shown that NF-κB binds to a polymorphic repressor element in the MMP-3 promoter in competition with zinc-binding protein 89 (ZBP-89) to limit IL-1 induced transcription [54], unpublished]. Further study is needed to determine more precisely the direct and indirect roles of NF-κB in MMP-3 regulation and how these roles are affected by any alterations in eicosanoid synthesis or actions that might take place in the context of chronic inflammation.


In summary, these data demonstrate that the ability of IL-4 to suppress IL-1 induced expression of MMP-3 does not involve activation of PPARγ and/or lipoxygenase activity in HGF. However, the fact that lipoxygenase inhibition and PPARγ activation were both able to super-induce MMP-3 mRNA suggests that these pathways are involved in MMP-3 gene regulation. These results also suggest that treatment with drugs that target these pathways in the context of chronic inflammation could have some unpredicted effects. Further study is necessary to determine how these effects are mediated and to what extent they are relevant to the disease process(es).


Cell culture

Human gingival tissue from patients undergoing periodontal surgery was obtained from Howard M. Sobel, D.D.S. and Kevan S. Green, D.M.D. of Sobel Periodontal Associates, P.C. The tissue was processed by enzymatic dispersion to produce primary cultures. Cells were maintained in Eagle's Minimal Essential Medium (EMEM) supplemented with 10% fetal bovine serum and antibiotic/antimycotic (penicillin, streptomycin, amphotericin; Gibco BRL, Grand Island, NY). Cells between passages 3 and 5 were used for experiments. COS-1 cells were obtained from ATCC and maintained as suggested.

RNA isolation and real-time PCR

Cells were serum-deprived for 16 hours in serum-free EMEM supplemented with 10% ITS (insulin, transferrin, sodium selenite; Sigma, St. Louis, MO) prior to the addition of NDGA, MK886, pioglitazone, 15dPGJ2 or GW9962 (Sigma) in the indicated doses. After one hour incubation, 10 ng IL-1β/ml (DuPont-Merck Corp., Wilmington, DE) was added, in the presence or absence of 10 ng/ml IL-4 (Gibco BRL, Grand Island, NY). Total RNA was isolated 6 or 12 hours later using the RNAqueous-4PCR kit (Ambion, Austin, TX) according to manufacture's instructions and reverse transcribed into cDNA using the High Capacity cDNA Archive Kit (Applied Biosystem, Foster City, CA) and Thermal Cycler Genius. Real Time PCR reactions were consisted of 2.5 μl of cDNA, 12.5 μl of Taqman Universal PCR master mix (Applied Biosystem), 8.75 μl H2O and 1.25 μl probes (stromylsin-MMP-3, collagenase I-MMP-1, Glyceraldehyde-3-Phosphate Dehydrogenase-GAPDH; Applied Biosystem) or 2 μl of cDNA, 6.8 μl of H2O, 10 μl of the Premix Ex Taq™ (master mix and 0.4 μl ROX Reference Dye; TAKARA, Madison, WI) and 0.8 μl probes. Real Time PCR analysis was done using the Applied Biosystem 7500 Real Time PCR system. Reactions were done in triplicate and results were normalized to GAPDH.

Nuclear extract isolation and gelshift assays

Nuclear extracts were isolated according to the method of Schreiber et al. [78] and quantified in mini-Bradford assays (Pierce, Rockford, IL). Synthetic oligonucleotides corresponding to the putative composite PPRE/AP-1 site (5' GAAAGCAAGGTGAGTCAAGCTG 3') [45] were labelled by T4 polynucleotide kinase in the presence of γ32P-ATP. Binding reactions contained 5 μg protein, 20 mM Hepes-OH pH 7, 50 mM NaCl, 0.2 M EDTA, 5% glycerol, 4 μg dIdC and 10,000 cpm probe.

Western Blotting

Fifteen μg nuclear extract were separated on 10% SDS-polyacrylamide gels. Proteins were transferred to Immobilon-P Transfer Membrane (Millipore) and the membrane was blocked overnight with Super Block blocking buffer (Pierce). The blot was then incubated with anti-PPAR-γ antibody (Santa Cruz) diluted 1:1000 in Super Block for one hour at room temperature. After washing three times in TBST (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% Tween 20), the blots were incubated with a goat anti-rabbit secondary antibody conjugated to horseradish peroxidase (Pierce) for one hour. After three more washes in TBST, the blot was incubated with SuperSignal West Pico Chemiluminescent Substrate (Pierce) and exposed to X-ray film.

Transient transfection

A luciferase reporter construct containing 2300 bp of the MMP-3 5' flanking region and the 5T promoter polymorphism has been described previously [79]. Transient transfections were performed in triplicate using Lipofectamine Plus (GibcoBRL), with SV-βgal as a control for transfection efficiency. Cells were harvested 36 hours later.

Determination of MMP-3 protein levels

MP-3 protein levels were quantitated by ELISA (Calbiochem, Darmstadt, Germany) in conditioned media of human gingival fibroblasts (HGF) that were untreated, treated with 10 ng IL-1/ml alone or treated with both 10 ng IL-1/ml and 0.1, 1.0 or 10 μM MK886 for 24 hours.

Authors' contributions

DS participated in drafting the manuscript and performed real-time PCR experiments with NDGA and pioglitazone; MJ performed the Western blot and EMSA, as well as real-time PCR and transfection with 15dPGJ2; MC and CG completed the real-time PCR experiments with MK886 and GW9662. MC did the MMP-3 ELISA and MK886 transfection experiments. GG participated in analysis of real-time PCR data. RCB conceived the experiments, analyzed the results and completed the manuscript. All authors approved the manuscript.


The authors would like to thank Bill Laidlaw for technical assistance, and Howard M. Sobel, D.D.S. and Kevan S. Greene, D.M.D. for providing gingival tissue samples. This work was funded by grant R15DE16277 from the NIH/NIDCR to RCB.


  1. Parsons SL, Watson SA, Brown PD, Collins HM, Steele RJ: Matrix metalloproteinases.

    Br J Surg 1997, 84:160-166. PubMed Abstract | Publisher Full Text OpenURL

  2. Knauper V, Wilhelm SM, Seperack PK, DeClerck YA, Langley KE, Osthues A, Tschesche H: Direct activation of human neutrophil procollagenase by recombinant stromelysin.

    Biochem J 1993, 295:581-586. PubMed Abstract | PubMed Central Full Text OpenURL

  3. Murphy G, Cockett MI, Stephens PE, Smith BJ, Docherty AJ: Stromelysin is an activator of procollagenase. A study with natural and recombinant enzymes.

    Biochem J 1987, 248:265-268. PubMed Abstract | PubMed Central Full Text OpenURL

  4. Ogata Y, Enghild JJ, Nagase H: Matrix metalloproteinase 3 (stromelysin) activates the precursor for the human matrix metalloproteinase 9.

    J Biol Chem 1992, 267:3581-3584. PubMed Abstract OpenURL

  5. Lijnen HR, Arza B, Van Hoef B, Collen D, Declerck PJ: Inactivation of plasminogen activator inhibitor-1 by specific proteolysis with stromelysin-1 (MMP-3).

    J Biol Chem 2000, 275:37645-37650. PubMed Abstract | Publisher Full Text OpenURL

  6. Noe V, Fingleton B, Jacobs K, Crawford HC, Vermeulen S, Steelant W, Bruyneel E, Matrisian LM, Mareel M: Release of an invasion promoter E-cadherin fragment by matrilysin and stromelysin-1.

    J Cell Sci 2001, 114:111-118. PubMed Abstract OpenURL

  7. Matsuno H, Yudoh K, Watanabe Y, Nakazawa F, Aono H, Kimura T: Stromelysin-1 (MMP-3) in synovial fluid of patients with rheumatoid arthritis has potential to cleave membrane bound Fas ligand.

    J Rheumatol 2001, 28:22-28. PubMed Abstract OpenURL

  8. Aiba T, Akeno N, Kawane T, Okamoto H, Horiuchi N: Matrix metalloproteinases-1 and -8 and TIMP-1 mRNA levels in normal and diseased human gingivae.

    Eur J Oral Sci 1996, 104:562-569. PubMed Abstract OpenURL

  9. Haerian A, Adonogianaki E, Mooney J, Docherty JP, Kinane DF: Gingival crevicular stromelysin, collagenase and tissue inhibitor of metalloproteinases levels in healthy and diseased sites.

    J Clin Periodontol 1995, 22:505-509. PubMed Abstract | Publisher Full Text OpenURL

  10. Reynolds JJ, Hembry RM, Meikle MC: Connective tissue degradation in health and periodontal disease and the roles of matrix metalloproteinases and their natural inhibitors.

    Adv Dent Res 1994, 8:312-319. PubMed Abstract OpenURL

  11. Alpagot T, Bell C, Lundergan W, Chambers DW, Rudin R: Longitudinal evaluation of GCF MMP-3 and TIMP-1 levels as prognostic factors for progression of periodontitis.

    J Clin Periodontol 2001, 28:353-359. PubMed Abstract | Publisher Full Text OpenURL

  12. Moissec P, Naviliat M, D’Angeac AD, Sany J, Banchereau J: Low levels of interleukin-4 and high level of transforming growth factor b in rheumatoid arthritis.

    Arthritis Rheum 1990, 33:1180-1187. PubMed Abstract OpenURL

  13. Yoon S, Tromp G, Vongpunsawad S, Ronkainen A, Juvonen T, Kuivaniemi H: Genetic analysis of MMP3, MMP9, and PAI-1 in Finnish patients with abdominal aortic or intracranial aneurysms.

    Biochem Biophys Res Commun 1999, 265:563-568. PubMed Abstract | Publisher Full Text OpenURL

  14. Lamblin N, Bauters C, Hermant X, Lablanche JM, Helbecque N, Amouyel P: Polymorphisms in the promoter regions of MMP-2, MMP-3, MMP-9 and MMP-12 genes as determinants of aneurysmal coronary artery disease.

    J Am Coll Cardiol 2002, 40:43-48. PubMed Abstract | Publisher Full Text OpenURL

  15. Beyzade S, Zhang S, Wong YK, Day IN, Eriksson P, Ye S: Influences of matrix metalloproteinase-3 gene variation on extent of coronary atherosclerosis and risk of myocardial infarction.

    J Am Coll Cardiol 2003, 41:2130-2137. PubMed Abstract | Publisher Full Text OpenURL

  16. Ye S, Watts GF, Mandalia S, Humphries SE, Henney AM: Preliminary report: genetic variation in the human stromelysin promoter is associated with progression of coronary atherosclerosis.

    Br Heart J 1995, 73:209-215. PubMed Abstract OpenURL

  17. Honig J, Rordorf-Adam C, Siegmund C, Wiedemann W, Erard F: Increased interleukin-1 beta (IL-1 beta) concentration in gingival tissue from periodontitis patients.

    J Periodontal Res 1989, 24:362-367. PubMed Abstract | Publisher Full Text OpenURL

  18. Stashenko P, Fujiyoshi P, Obernesser MS, Prostak L, Haffajee AD, Socransky SS: Levels of interleukin 1 beta in tissue from sites of active periodontal disease.

    J Clin Periodontol 1991, 18:548-554. PubMed Abstract | Publisher Full Text OpenURL

  19. Cheung NT, Dawes PT, Poulton KV, Ollier WE, Taylor DJ, Mattey DL: High serum levels of pro-matrix metalloproteinase-3 are associated with greater radiographic damage and the presence of the shared epitope in patients with rheumatoid arthritis.

    J Rheumatol 2000, 27:882-887. PubMed Abstract OpenURL

  20. van den Berg WB, Bresnihan B: Pathogenesis of joint damage in rheumatoid arthritis: evidence of a dominant role for interleukin-I.

    Baillieres Best Pract Res Clin Rheumatol 1999, 13:577-597. PubMed Abstract | Publisher Full Text OpenURL

  21. Shapira L, van Dyke TE, Hart TC: A localized absence of interleukin-4 triggers periodontal disease activity: a novel hypothesis.

    Med Hypotheses 1992, 39:319-322. PubMed Abstract | Publisher Full Text OpenURL

  22. Ukai T, Mori Y, Onoyama M, Hara Y: Immunohistological study of interferon-gamma- and interleukin-4-bearing cells in human periodontitis gingiva.

    Arch Oral Biol 2001, 46:901-908. PubMed Abstract | Publisher Full Text OpenURL

  23. Yamamoto M, Fujihashi K, Hiroi T, McGhee JR, Van Dyke TE, Kiyono H: Molecular and cellular mechanisms for periodontal diseases: role of Th1 and Th2 type cytokines in induction of mucosal inflammation.

    J Periodontal Res 1997, 32:115-119. PubMed Abstract | Publisher Full Text OpenURL

  24. van der Graaff WL, Prins AP, Niers TM, Dijkmans BA, van Lier RA: Quantitation of interferon gamma- and interleukin-4-producing T cells in synovial fluid and peripheral blood of arthritis patients.

    Rheumatology (Oxford) 1999, 38:214-220. PubMed Abstract | Publisher Full Text OpenURL

  25. Dolhain RJ, van der Heiden AN, ter Haar NT, Breedveld FC, Miltenberg AM: Shift toward T lymphocytes with a T helper 1 cytokine-secretion profile in the joints of patients with rheumatoid arthritis.

    Arthritis Rheum 1996, 39:1961-1969. PubMed Abstract | Publisher Full Text OpenURL

  26. Ejeil AL, Gaultier F, Igondjo-Tchen S, Senni K, Pellat B, Godeau G, Gogly B: Are cytokines linked to collagen breakdown during periodontal disease progression?

    J Periodontol 2003, 74:196-201. PubMed Abstract | Publisher Full Text OpenURL

  27. Michel J, Gonzales JR, Wunderlich D, Diete A, Herrmann JM, Meyle J: Interleukin-4 polymorphisms in early onset periodontitis.

    J Clin Periodontol 2001, 28:483-488. PubMed Abstract | Publisher Full Text OpenURL

  28. Jorgensen C, Apparailly F, Couret I, Canovas F, Jacquet C, Sany J: Interleukin-4 and interleukin-10 are chondroprotective and decrease mononuclear cell recruitment in human rheumatoid synovium in vivo.

    Immunology 1998, 93:518-523. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  29. Lubberts E, Joosten LA, van Den Bersselaar L, Helsen MM, Bakker AC, van Meurs JB, Graham FL, Richards CD, van Den Berg WB: Adenoviral vector-mediated overexpression of IL-4 in the knee joint of mice with collagen-induced arthritis prevents cartilage destruction.

    J Immunol 1999, 163:4546-4556. PubMed Abstract OpenURL

  30. Fukuda K, Fujitsu Y, Kumagai N, Nishida T: Inhibition of matrix metalloproteinase-3 synthesis in human conjunctival fibroblasts by interleukin-4 or interleukin-13.

    Invest Ophthalmol Vis Sci 2006, 47:2857-2864. PubMed Abstract | Publisher Full Text OpenURL

  31. Prontera C, Crescenzi G, Rotilio D: Inhibition by Interleukin-4 of stromelysin expression in human skin fibroblasts: role of PKC.

    Exp Cell Res 1996, 224:183-188. PubMed Abstract | Publisher Full Text OpenURL

  32. Shingu M, Miyauchi S, Nagai Y, Yasutake C, Horie K: The role of IL-4 and IL-6 in IL-1-dependent cartilage matrix degradation.

    Br J Rheumatol 1995, 34:101-106. PubMed Abstract | Publisher Full Text OpenURL

  33. Nemoto O, Yamada H, Kikuchi T, Shinmei M, Obata K, Sato H, Seiki M, Shimmei M: Suppression of matrix metalloproteinase-3 synthesis by interleukin-4 in human articular chondrocytes.

    J Rheumatol 1997, 24:1774-1779. PubMed Abstract OpenURL

  34. Borghaei RC, Rawlings PL Jr., Mochan E: Interleukin-4 suppression of interleukin-1-induced transcription of collagenase (MMP-1) and stromelysin 1 (MMP-3) in human synovial fibroblasts.

    Arthritis Rheum 1998, 41:1398-1406. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  35. Jenkins K, Javadi M, Borghaei RC: Interleukin-4 suppresses interleukin-1-induced expression of matrix metalloproteinase-3 in human gingival fibroblasts.

    J Periodontol 2004, 75:267-275. Publisher Full Text OpenURL

  36. Lehrke M, Lazar MA: The many faces of PPARgamma.

    Cell 2005, 123:993-999. PubMed Abstract | Publisher Full Text OpenURL

  37. Huang JT, Welch JS, Ricote M, Binder CJ, Willson TM, Kelly C, Witztum JL, Funk CD, Conrad D, Glass CK: Interleukin-4-dependent production of PPAR-gamma ligands in macrophages by 12/15-lipoxygenase.

    Nature 1999, 400:378-382. PubMed Abstract | Publisher Full Text OpenURL

  38. Ricote M, Welch JS, Glass CK: Regulation of macrophage gene expression by the peroxisome proliferator-activated receptor-gamma.

    Horm Res 2000, 54:275-280. PubMed Abstract | Publisher Full Text OpenURL

  39. Bendixen AC, Shevde NK, Dienger KM, Willson TM, Funk CD, Pike JW: IL-4 inhibits osteoclast formation through a direct action on osteoclast precursors via peroxisome proliferator-activated receptor gamma 1.

    Proc Natl Acad Sci U S A 2001, 98:2443-2448. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  40. Sabatini M, Bardiot A, Lesur C, Moulharat N, Thomas M, Richard I, Fradin A: Effects of agonists of peroxisome proliferator-activated receptor gamma on proteoglycan degradation and matrix metalloproteinase production in rat cartilage in vitro.

    Osteoarthritis Cartilage 2002, 10:673-679. PubMed Abstract | Publisher Full Text OpenURL

  41. Yamasaki S, Nakashima T, Kawakami A, Miyashita T, Ida H, Migita K, Nakata K, Eguchi K: Functional changes in rheumatoid fibroblast-like synovial cells through activation of peroxisome proliferator-activated receptor gamma-mediated signalling pathway.

    Clin Exp Immunol 2002, 129:379-384. PubMed Abstract | Publisher Full Text OpenURL

  42. Kobayashi T, Notoya K, Naito T, Unno S, Nakamura A, Martel-Pelletier J, Pelletier JP: Pioglitazone, a peroxisome proliferator-activated receptor gamma agonist, reduces the progression of experimental osteoarthritis in guinea pigs.

    Arthritis Rheum 2005, 52:479-487. PubMed Abstract | Publisher Full Text OpenURL

  43. Shiojiri T, Wada K, Nakajima A, Katayama K, Shibuya A, Kudo C, Kadowaki T, Mayumi T, Yura Y, Kamisaki Y: PPAR gamma ligands inhibit nitrotyrosine formation and inflammatory mediator expressions in adjuvant-induced rheumatoid arthritis mice.

    Eur J Pharmacol 2002, 448:231-238. PubMed Abstract | Publisher Full Text OpenURL

  44. Di Paola R, Mazzon E, Maiere D, Zito D, Britti D, De Majo M, Genovese T, Cuzzocrea S: Rosiglitazone reduces the evolution of experimental periodontitis in the rat.

    J Dent Res 2006, 85:156-161. PubMed Abstract OpenURL

  45. Francois M, Richette P, Tsagris L, Raymondjean M, Fulchignoni-Lataud MC, Forest C, Savouret JF, Corvol MT: Peroxisome proliferator-activated receptor-gamma down-regulates chondrocyte matrix metalloproteinase-1 via a novel composite element.

    J Biol Chem 2004, 279:28411-28418. PubMed Abstract | Publisher Full Text OpenURL

  46. Abdelrahman M, Sivarajah A, Thiemermann C: Beneficial effects of PPAR-gamma ligands in ischemia-reperfusion injury, inflammation and shock.

    Cardiovasc Res 2005, 65:772-781. PubMed Abstract | Publisher Full Text OpenURL

  47. Yki-Jarvinen H: Thiazolidinediones.

    N Engl J Med 2004, 351:1106-1118. PubMed Abstract | Publisher Full Text OpenURL

  48. Yamazaki F, Aragane Y, Maeda A, Matsushita K, Ueno K, Yudate T, Kawada A, Tezuka T: Overactivation of IL-4-induced activator protein-1 in atopic dermatitis.

    J Dermatol Sci 2002, 28:227-233. PubMed Abstract | Publisher Full Text OpenURL

  49. Chiu R, Angel P, Karin M: Jun-B differs in its biological properties from, and is a negative regulator of, c-Jun.

    Cell 1989, 59:979-986. PubMed Abstract | Publisher Full Text OpenURL

  50. Schutte J, Viallet J, Nau M, Segal S, Fedorko J, Minna J: jun-B inhibits and c-fos stimulates the transforming and trans-activating activities of c-jun.

    Cell 1989, 59:987-997. PubMed Abstract | Publisher Full Text OpenURL

  51. Park S, Lee DK, Yang CH: Inhibition of fos-jun-DNA complex formation by dihydroguaiaretic acid and in vitro cytotoxic effects on cancer cells.

    Cancer Lett 1998, 127:23-28. PubMed Abstract | Publisher Full Text OpenURL

  52. Sylvester J, Liacini A, Li WQ, Zafarullah M: Interleukin-17 signal transduction pathways implicated in inducing matrix metalloproteinase-3, -13 and aggrecanase-1 genes in articular chondrocytes.

    Cell Signal 2004, 16:469-476. PubMed Abstract | Publisher Full Text OpenURL

  53. Otani Y, Quinones S, Saus J, Kurkinen M, Harris Jr. ED: Cycloheximide induces styromelysin mRNA in cultured human fibroblasts.

    Eur J Biochem 1990, 192:75-79. PubMed Abstract | Publisher Full Text OpenURL

  54. Borghaei RC, Rawlings PL Jr., Javadi M, Woloshin J: NF-kappaB binds to a polymorphic repressor element in the MMP-3 promoter.

    Biochem Biophys Res Commun 2004, 316:182-188. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  55. Sun D, Funk CD: Disruption of 12/15-lipoxygenase expression in peritoneal macrophages. Enhanced utilization of the 5-lipoxygenase pathway and diminished oxidation of low density lipoprotein.

    J Biol Chem 1996, 271:24055-24062. PubMed Abstract | Publisher Full Text OpenURL

  56. Spanbroek R, Hildner M, Kohler A, Muller A, Zintl F, Kuhn H, Radmark O, Samuelsson B, Habenicht AJ: IL-4 determines eicosanoid formation in dendritic cells by down-regulation of 5-lipoxygenase and up-regulation of 15-lipoxygenase 1 expression.

    Proc Natl Acad Sci U S A 2001, 98:5152-5157. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  57. Tsubouchi Y, Kawahito Y, Kohno M, Inoue K, Hla T, Sano H: Feedback control of the arachidonate cascade in rheumatoid synoviocytes by 15-deoxy-Delta(12,14)-prostaglandin J2.

    Biochem Biophys Res Commun 2001, 283:750-755. PubMed Abstract | Publisher Full Text OpenURL

  58. Avis I, Martinez A, Tauler J, Zudaire E, Mayburd A, Abu-Ghazaleh R, Ondrey F, Mulshine JL: Inhibitors of the arachidonic acid pathway and peroxisome proliferator-activated receptor ligands have superadditive effects on lung cancer growth inhibition.

    Cancer Res 2005, 65:4181-4190. PubMed Abstract | Publisher Full Text OpenURL

  59. Inoue H, Tanabe T, Umesono K: Feedback control of cyclooxygenase-2 expression through PPARgamma.

    J Biol Chem 2000, 275:28028-28032. PubMed Abstract OpenURL

  60. Thampatty BP, Im HJ, Wang JH: Leukotriene B4 at low dosage negates the catabolic effect of prostaglandin E2 in human patellar tendon fibroblasts.

    Gene 2006, 372:103-109. PubMed Abstract | Publisher Full Text OpenURL

  61. Domeij H, Yucel-Lindberg T, Modeer T: Signal pathways involved in the production of MMP-1 and MMP-3 in human gingival fibroblasts.

    Eur J Oral Sci 2002, 110:302-306. PubMed Abstract | Publisher Full Text OpenURL

  62. Case JP, Lafyatis R, Kumkumian GK, Remmers EF, Wilder RL: IL-1 regulation of transin/stromelysin transcription in rheumatoid synovial fibroblasts appears to involve two antagonistic transduction pathways, an inhibitory, prostaglandin-dependent pathway mediated by cAMP, and a stimulatory, protein kinase C-dependent pathway.

    J Immunol 1990, 145:3755-3761. PubMed Abstract OpenURL

  63. DiBattista JA, Martel-Pelletier J, Fujimoto N, Obata K, Zafarullah M, Pelletier JP: Prostaglandins E2 and E1 inhibit cytokine-induced metalloprotease expression in human synovial fibroblasts. Mediation by cyclic-AMP signalling pathway.

    Lab Invest 1994, 71:270-278. PubMed Abstract OpenURL

  64. Yan M, Noguchi K, Ruwanpura SM, Ishikawa I: Cyclooxygenase-2-dependent prostaglandin (PG) E2 downregulates matrix metalloproteinase-3 production via EP2/EP4 subtypes of PGE2 receptors in human periodontal ligament cells stimulated with interleukin-1alpha.

    J Periodontol 2005, 76:929-935. PubMed Abstract | Publisher Full Text OpenURL

  65. Mauviel A, Halcin C, Vasiloudes P, Parks WC, Kurkinen M, Uitto J: Uncoordinate regulation of collagenase, stromelysin, and tissue inhibitor of metalloproteinases genes by prostaglandin E2: selective enhancement of collagenase gene expression in human dermal fibroblasts in culture.

    J Cell Biochem 1994, 54:465-472. PubMed Abstract | Publisher Full Text OpenURL

  66. Ruwanpura SM, Noguchi K, Ishikawa I: Prostaglandin E2 regulates interleukin-1beta-induced matrix metalloproteinase-3 production in human gingival fibroblasts.

    J Dent Res 2004, 83:260-265. PubMed Abstract OpenURL

  67. Genomatix [] webcite

  68. Lemay DG, Hwang DH: Genome-wide identification of peroxisome proliferator response elements using integrated computational genomics.

    J Lipid Res 2006. PubMed Abstract OpenURL

  69. Giri S, Rattan R, Singh AK, Singh I: The 15-deoxy-delta12,14-prostaglandin J2 inhibits the inflammatory response in primary rat astrocytes via down-regulating multiple steps in phosphatidylinositol 3-kinase-Akt-NF-kappaB-p300 pathway independent of peroxisome proliferator-activated receptor gamma.

    J Immunol 2004, 173:5196-5208. PubMed Abstract OpenURL

  70. Lebrasseur NK, Kelly M, Tsao TS, Farmer SR, Saha AK, Ruderman NB, Tomas E: Thiazolidinediones can rapidly activate AMP-activated protein kinase in mammalian tissues.

    Am J Physiol Endocrinol Metab 2006, 291:E175-81. PubMed Abstract | Publisher Full Text OpenURL

  71. Tsukamoto H, Hishinuma T, Suzuki N, Tayama R, Hiratsuka M, Yoshihisa T, Mizugaki M, Goto J: Thiazolidinediones increase arachidonic acid release and subsequent prostanoid production in a peroxisome proliferator-activated receptor gamma-independent manner.

    Prostaglandins Other Lipid Mediat 2004, 73:191-213. PubMed Abstract | Publisher Full Text OpenURL

  72. Aizawa Y, Kawabe J, Hasebe N, Takehara N, Kikuchi K: Pioglitazone enhances cytokine-induced apoptosis in vascular smooth muscle cells and reduces intimal hyperplasia.

    Circulation 2001, 104:455-460. PubMed Abstract OpenURL

  73. Floriano-Sanchez E, Villanueva C, Medina-Campos ON, Rocha D, Sanchez-Gonzalez DJ, Cardenas-Rodriguez N, Pedraza-Chaverri J: Nordihydroguaiaretic acid is a potent in vitro scavenger of peroxynitrite, singlet oxygen, hydroxyl radical, superoxide anion and hypochlorous acid and prevents in vivo ozone-induced tyrosine nitration in lungs.

    Free Radic Res 2006, 40:523-533. PubMed Abstract | Publisher Full Text OpenURL

  74. Mehta JL, Hu B, Chen J, Li D: Pioglitazone inhibits LOX-1 expression in human coronary artery endothelial cells by reducing intracellular superoxide radical generation.

    Arterioscler Thromb Vasc Biol 2003, 23:2203-2208. PubMed Abstract | Publisher Full Text OpenURL

  75. Bond M, Chase AJ, Baker AH, Newby AC: Inhibition of transcription factor NF-kappaB reduces matrix metalloproteinase-1, -3 and -9 production by vascular smooth muscle cells.

    Cardiovasc Res 2001, 50:556-565. PubMed Abstract | Publisher Full Text OpenURL

  76. Bondeson J, Brennan F, Foxwell B, Feldmann M: Effective adenoviral transfer of IkappaBalpha into human fibroblasts and chondrosarcoma cells reveals that the induction of matrix metalloproteinases and proinflammatory cytokines is nuclear factor-kappaB dependent.

    J Rheumatol 2000, 27:2078-2089. PubMed Abstract OpenURL

  77. Chase AJ, Bond M, Crook MF, Newby AC: Role of nuclear factor-kappa B activation in metalloproteinase-1, -3, and -9 secretion by human macrophages in vitro and rabbit foam cells produced in vivo.

    Arterioscler Thromb Vasc Biol 2002, 22:765-771. PubMed Abstract | Publisher Full Text OpenURL

  78. Schreiber E, Matthais P, Muller MM, Schaffner W: Rapid detection of octamer binding protein with ‘mini-extracts’ prepared from a small number of cells.

    Nuc Acids Res 1989, 17:6419. Publisher Full Text OpenURL

  79. Borghaei RC, Sullivan C, Mochan E: Identification of a cytokine-induced repressor of interleukin-1 stimulated expression of stromelysin 1 (MMP-3).

    J Biol Chem 1999, 274:2126-2131. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL