Table 1

Oligonucleotides used as primers in RT-PCR analysis

Target mRNA

Primer Sequence

Amplicon Size (bp)


TPS1

Forward CGCTAAGGCGCAACTGACCTCGTCT

Reverse CGACGAGAATGCGTGGTTGGCATAC

379

TPS2

Forward CCCCCCAAACTATCAGATTGGAACAAC

Reverse ACCCAGCTGCAGCTATTCCATCGGC

612

PDA1

Forward GGTCAGGAGGCCATTGCTGT

Reverse GACCAGCAATTGGATCGTTCTTGG

673

CNA1

Forward CGAAAGACTTGAATTCTTCACGCATC

Reverse GAATGATCTGCAGCAAGCATCG

629

CNA2

Forward CCTTATATCTGTTCCCGCCC

Reverse GAGGAACCATGGTTTTGGAG

551

ACT1

Forward CCTACGTTGGTGATGAAGCT

Reverse GTCAGTCAAATCTCTACCGG

407


CNA1, CNA2, PDA1 and ACT1 primer sequences were obtained from Del Aguila et al, 2003 and TPS1 and TPS2, from Souza, 2001.

Del Aguila et al. BMC Molecular Biology 2005 6:9   doi:10.1186/1471-2199-6-9

Open Data