Table 1

Pseudo attP sites in pig kidney PK15 cell line
Site Sequencea,b Identity to attP (%)c Genomic location Integration frequencyd
attP CCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGG 100
5113 AAGGATTTGGATTTCATC TGT GTATGCTCAGTACTTTTT 18 Chr1, ﹢ , 114220089–114220127,Int.Ge 2/6 = 33%
5156 TGGATTTGGGTGCCACGG TGA CTCAGATGGGATGCCGGG 26 Chr7, ﹣ , 45581124–45581162,Int.G 2/6 = 33%
1015 GCCTGGTATCATCAAACA TTTATGGGATCTCTGCCATGT 23 Chr9, ﹣ , 42746366–42746404,Int.G 1/6 = 17%
2015 ATACCCCCAATATAGCTC TGAAATACCAATGGGTGTTCC 31 Chr3, ﹣ , 54698718–54698756,Int.G 1/6 = 17%

aThe TTG core in the wild-type attP site and similar core in pseudo attP site of pig genome are shown in bold.

bNucleotides identical to the wild-type site at that position are underlined.

cThe identity is calculated by Bioedit.

dIntegration frequency = recombination clones/total selected clones × 100%.

eInt.G, intergenic region.

Bi et al.

Bi et al. BMC Molecular Biology 2013 14:20   doi:10.1186/1471-2199-14-20

Open Data