Table 1

Primer sequences for the Real-Time PCR Analysis
gene name Abbreviation Acc No Sequence Product size
Annexin ANXA1 NM_000700 forward 5´- GCAGGCCTGGTTTATTGAAA −3´ 203 bp
reverse 5´- GCTGTGCATTGTTTCGCTTA −3´
Cyp24A1 CYP24 NM_000782 forward 5´- GGCAACAGTTCTGGGTGAAT −3´ 249 bp
reverse 5´- TATTTGCGGACAATCCAACA −3´
Osteopontin ON NM_000582 forward 5´- TGAAACGAGTCAGCTGGATG −3´ 162 bp
reverse 5´- TGAAATTCATGGCTGTGGAA −3´
PIM-1 kinase PIM1 NM_002648 forward 5´- CAGAGTGGATCCGCTACCAT −3´ 226 bp
reverse 5´- TGGATTTCTTCGAAGGTTGG −3´

Maier et al.

Maier et al. BMC Molecular Biology 2012 13:18   doi:10.1186/1471-2199-13-18

Open Data