Table 1

Selected candidate reference genes, primers and different parameters derived from qRT-PCR analysis

Gene name

GenBank accession number

Primer sequences

(forward/reverse)

Tm (°C)

Amplicon length (bp)

Amplification efficiency (%)

*S.D of efficiency

Average Cp of cDNA

**R2


ACT

EF528575

CCAAATCCAGCTCATCAGTCG

TCTTTCGGCTCCGATGGTGAT

80.26

74

94.31

0.123

24.29

0.9992


TUB

AF101419

GCACGGCATTGATGTGACC

GAACAAACCTCCCGCCACT

82.56

101

95.77

0.0094

20.65

0.9995


NADHD

L39390

TGCAGCAAAGGCTTGTCAAA

TCGAAACTTCCCGTTATCCAA

75.84

102

84.89

0.0104

27.12

0.9989


EF

AY378166

CATGCGTCAGACGGTTGCTGT

CTTCACTCCCTTCTTGGCTGC

82.17

100

98.17

0.0055

19.11

0.9999


H3

AY378165

ACAGCTCGCAAATCAACCG

GCGGCTTCTTCACTCCACC

83.79

100

94.49

0.0059

26.46

0.9998


rRNA

U42501

GGCGACGCATCATTCAAAT

TCCGGAATCGAACCCTAAT

80.61

102

91.27

0.0107

7.11

0.9992


GAPDH

AGGGCGGTGCTAAGAAAGTCA

TCTGGCTTGTATTCCTTCTCATT

81.55

91

91.04

0.0037

29.58

0.9999


FEHIIa/FEHIIb

AY323935/AJ295034.1

TAAAGACTTGAAAGAACAAAGTG

CGCACCATAACTTGTCGTGTCG

78.98

135

82.24

0.0116

31.53

0.9981


*S.D, standard deviation; **R2, correlation coefficient of the slope of the standard curve

Maroufi et al. BMC Molecular Biology 2010 11:15   doi:10.1186/1471-2199-11-15

Open Data