Table 8

Nucleotide sequences of the primers used in the qPCR reactions and the length of the amplicons generated

Transcript (amplicon length)

Primer

Sequence (5' to 3')


Fluc (137 nts)

prMJ296

AGGTGGCTCCCGCTGAAT

prMJ297

FAM-CGGGAAGACCTGCGACACCTGCGT-BHQ1

prMJ298

CATCGTCTTTCCGTGCTCCA


Rluc (140 nts)

prMJ274

GCAGAAGTTGGTCGTGAGG

prMJ272

HEX-CTCACTATAGGCTAGCCACCATGACTTCGAAAG-BHQ1

prMJ276

TCATCCGTTTCCTTTGTTCTG


B2M (125 nts)

prMJ348

TCTCTGCTCCCCACCTCTAA

prMJ349

FAM-CCAGCCCTCCTAGAGCTACC-BHQ1

prMJ350

ATCTGAGCAGGTTGCTCCAC


ActB (142 nts)

prMJ351

CTCGGCCACATTGTGAACTT

prMJ352

FAM-ATGCTCGCTCCAACCGAC-BHQ1

prMJ353

AACGGTGAAGGTGACAGCA


Abbreviations: BHQ1- Black Hole Quencher 1, FAM- Fluorescein, HEX- hexachlorofluorescein phosphoramidite

Jiwaji et al. BMC Molecular Biology 2010 11:103   doi:10.1186/1471-2199-11-103

Open Data