Table 2

Novel miRNA candidates identified in this study

ID

Sequencea

Genomic location

Strand

Numberb

Conservationc


bta-un01

AAAAACCUGAGUGAACUUUUC

chr16:7583053-7583073

chr27:21096115-21096135

-

+

1

bta-un02

AAACAUCUGGUUGGUUGAGAGA

chrX:3009839-3009860

-

1

D; E

bta-un03

AAACCCGAACGAACUUUUGGGCC

chr5:124162584-124162606

chr12:31995980-31996002

chr24:34630276-34630298

chr24:42515045-42515067

-

-

+

+

1

bta-un04

AAAGCUGAAUGAACUUUUUGGC

chr14:58301736-58301757

chrX:291566-291587

chrUn.004.21:72057047-72057068

+

+

+

1

bta-un05

UUUGCACCUCUGAGAGUGGAG

chr7:49895499-49895519

+

1

H; C; E

bta-un06

AACCCCAGAGAAACUUUCUGGC

chr8:43938121-43938142

-

1

bta-un07

AAGAGUUUGUUCGGGUUUCUC

chrUn.004.13:739780-739800

+

2

bta-un08

AAGUACAGGAUGCCCAAUGAAU

chr21:65541270-65541291

-

1

bta-un09

AGCCCUUCCCUUUCACUGGCCU

chr28:32693949-32693969

-

3

E

bta-un10

AGCGAGGUUGCCCUUUGUAUAU*

chr21:66021949-66021970

+

1

H; M; R; C; E

bta-un11

CAGUCCGGUCCCGCGGUGUCUCC

chr1:76369850-76369872

+

1

bta-un12

CCUCAGUCAGCCUUGUGGAUGU

chrX:21829475-21829496

-

56

H; E

bta-un13

GAAGUUGCCCAUGUUCUUUUCG*

chr21:66012119-66012140

+

1

H; M; R; C; E

bta-un14

GAGAGAUCAGAGGCGCAGAGU

chr1:65888852-65888872

-

2

H; C; E

bta-un15

GCGGCCCGCGGGCUCGGAUGCUA

chr1:76369888-76369908

+

1

bta-un16

UUACUCUGAGUAACCUAACUGU

chr26:31723064-31723084

+

1

bta-un17

GGACUUCCCUGGUAGCUCAGC

chrX:18300110-18300129

chrX:82012989-82013008

+

-

2

bta-un18

GGUUGAUCAGAGAACAUACAUU

chr21:66028357-66028378

+

1

H; C; E

bta-un19

GUCAGGAUGGCCGAGUGGUC

chr7:42028223-42028242

+

1

bta-un20

GUGGUUAUCCCUGCUGUGUUCG*

chr21:66028745-66028766

+

1

H; C; E

bta-un21

UCCCCUUCCUUCCGGCCUCCGCC

chr21:68561367-68561389

+

1

bta-un22

UCCGCCUUGUGCUUCCUGCAU

chr11:102046802-102046821

+

1

bta-un23

UGAAAAGUUCGUUCGGGUUUUU

chr1:3474029-3474049

-

9

bta-un24

UGCGGGAUCUUUAGUUGUGGUG

chr21:55700383-55700404

chr25:35972465-35972486

-

-

6

bta-un25

UGGGGGGAGGCCACACCAUGUCA

chr7:5546190-5546212

-

1

bta-un26

UUGUGGCCGCAGCAACCUCGGU

chr10:66855690-66855711

chr10:66857969-66857990

-

+

1

H; M; R; C; E

bta-un27

UUCGACUCCCGGUGUGGGAACCA

chr12:14082775-14082795

chrUn.004.4221:9671-9691

-

+

1

H; M; R; C; E; G

bta-un28

GUGGACUUCCCUGGUAGCUCAGCU

chr4:106953595-106953618

+

1

bta-un29

GUCAGGAUGGCCGAGCGGUCU

chr3:8630409-8630429

+

1

H; M; R; C


aSome miRNA candidates had end variants. The sequence shown here was the most frequently identified in all the libraries. bThe total number of novel miRNA candidate in all sequenced clones.

cConservation of bovine miRNA candidates was evaluated in human (Homo sapiens, H), mouse (Mus musculus, M), and rat (Rattus norvegicus, R), dog (Canis familiaris, C), horse (Equus caballus, E), chicken (Gallus gallus, G) genomes.]

*Indicating that the precursor of miRNA candidate was reported in bovine and other species as well as the other arm of the precursor was reported as miRNA.

Jin et al. BMC Molecular Biology 2009 10:90   doi:10.1186/1471-2199-10-90

Open Data