Table 2

Primers and probes for RACE and real-time PCR

Primers

Assay

Primer

Position

Sequence


RACE

5'RACE nested

48852556

CCTCTCACAGCTCATGTCTGAT

RACE

5'RACE

48852500

ACCACATCCAGGCACTGTTCTTC

RACE

3'RACE

48852519

GAACAGTGCCTGGATGTGGTGAC

PCR/Real-time

uPAR Fwd E1

48866085

CTGCTGCTGCTCCACACCT

PCR/Real-time

uPAR Rev E7

48845002

TGGGTGGTTACAGCCACTTT

PCR/Real-time

uPAR Rev E7b

48842344

ATCACATCTGCTGGGGCTAC

PCR/Real-time

uPAR Rev E2

48863624

ACTCTTCCACACGGCAATCCC

PCR/Real-time

uPAR Rev E7b

(long UTR)

48842223

GCCTGTCCTTCCATGATGTT


Probes

Assay

TaqMan Probe

Location

Sequence ('denotes exon boundary)


Real-time PCR

Exon 1–2

Exon1–2

CCAGCCTCTTGGGGCCTGCGGT

Real-time PCR

Exon 5 del

Exon4–6

AGCTCCAGGA'CTTCTTCACCTTCC

Real-time PCR

Exon 3 del

Exon 2–4

CAGCCCGGC'CTTCCCACAAGCG

Real-time PCR

Exon 6 del +E7

Exon 5–7

TTCGGTT'TTGGGCCCTCGTTGCAT

Real-time PCR

Exon 6 del +E7b

Exon 5–7b

TTCCCCAGAGTGAGCGTT'TTGGGC

Real-time PCR

Exon 5+6 del +E7

Exon 4–7

TCCAGGAAGGTGAAGAAG'AACCGAAA

Real-time PCR

Exon 5+6 del; E7b

Exon 4–7b

CCCAGAGTGAGCGTT'CTTCTTCACC

Real-time PCR

Exon 4+5 del

Exon 3–6

TGCAACCAGGGCAACTCTG'TCCT


Primers listed for RACE were used with RACE-specific primers from GeneRacer kit (Invitrogen). Other primers were used to amplify full-length uPAR for both standard PCR and real-time assays. All TaqMan probes were labelled with Fam and TAMRA and were used with appropriate primers. Primer location is listed relative to chromosome 19 reference sequence for the start of the primer.

Stewart and Sayers BMC Molecular Biology 2009 10:75   doi:10.1186/1471-2199-10-75

Open Data