Table 1

Seven sequences that were used for creating ColR binding consensus

Sequencea

Locus/Gene

Product


ACGATAGTTCAGCCTTTTTTCACGTTTTTTTCACAACGCAAAGCTTTGCA

PP0737

conserved hypothetical protein


TGAAATGCCCACATAGGCTTCACACTTTTTTCACAAGGACTGGCTCAGTA

PP3766/gloA

lactoylglutathione lyase


TTACGCATTTACATTTAGTTCACTATTTTTTCACCTTTGCCTCCATAGGC

PP0035

GtrA family protein


GGGGAAAATTCACCGCACTTGACGGTTTTTTCACTGATCCTTCACGGACA

PP0900

PAP2 family protein


GCATCGCATTATCAGCGGCTAAGATTTTTTTGACGAAATATTGACAAGCT

PP2561

secreted hemolysin-type calcium-binding bacteriocin, putative


GGTTATATCAACCTGCATTTCACGACTTTTTGACATTTGTAATCGCACAC

PP0267/oprQ

outer membrane protein OprE3


TATCAGGTCAACGGGTGCCCAACGTTTTTTTCACATTGGCATGACCTGAT

PP0903

conserved hypothetical protein


a Most conserved 16-bp-long sequences that were used as input in the final regulon prediction are indicated in bold

Kivistik et al. BMC Molecular Biology 2009 10:46   doi:10.1186/1471-2199-10-46

Open Data