Table 2

Candidate reference genes and primer sequences used for quantitative PCR analysis

Gene name

Source gene a

Gene description

Primer sequence b

Amplicon length (bp)


poly

SGN-U347154

hexameric polyubiquitin

5' CGCTGACTACAATATCCAAAAGGA 3'

67

5' CTGCATTCCACCCCTCAGA 3'

adh

SGN-U350348

alcohol dehydrogenase class III

5' CCTCAAGCCGGCGAAGT 3'

55

5' CTGTATGGCAGAGGGCAGTGT 3'

actin

SGN-U353034

actin 7

5' AATTGTCCGTGACATCAAGGAA 3'

82

5' TGAGCTGCTCTTGGCTGTTTC 3'

gapdh

SGN-U347734

glyceraldehyde-3-phosphate dehydrogenase

5' TTGAAGGGCGGTGCAAA 3'

59

5' AACATGGGTGCATCCTTGCT 3'

rpl7

SGN-U351477

60S ribosomal protein L7

5' CATTCGAGGTATCAATGCTATGCA 3'

66

5' TGTCTCAGGCGCAGAAGCT 3'

ccs

SGN-U350284

caffeine synthase 1

5' CAATGCCCGGCTCTTTCTAC 3'

68

5' GTAACAAGAGTGTAAAAAATGCATGGA 3'

cys

SGN-U352616

cysteine proteinase

5' GCGATCGCTACCGTCCAA 3'

63

5' CTTTTTCTCTCCAGTCAATGGAGTT 3'

14-3-3

SGN-U356404

14-3-3 protein

5' TGTGCTCTTTAGCTTCCAAACG 3'

75

5' CTTCACGAGACATATTGTCTTACTCAAA 3'


a Unigene accession number according to the SOL Genomics Network [65]

b Forward (upper line) and reverse (lower line) primer sequences

Barsalobres-Cavallari et al. BMC Molecular Biology 2009 10:1   doi:10.1186/1471-2199-10-1

Open Data