Table 1

Primers used in these study (5' to 3' sequence)

PA2939

expression forward

TTACCGGAATTCATGAGCAACAAGAACA

expression reverse

AACGGCAAGCTTTTACTTGATGAAGTCG

KO up forward

TGTAACTAGTATGGTCAGCACATGTTGCA

KO up reverse

GCCAGGGATGCGGCGGAATTCGAGAGGGCGAGGGCG

KO down forward

CGCCCTCGCCCTCTCGAATTCCGCCGCATCCCTGGC

KO down reverse

CTGACCTCGAGTTACTTGATGAAGTCGTGAC

TetR cassette from pACYC184

EcoRI Tet forward

GGTTATGAATTCGGTAGCTCAGAGAACCCTTCG

EcoRI Tet reverse

GTGTTAGAATTCGATATGTTCTGCCAAGGGTT

Xho Tet forward

CCGGCTCGAGGGTAGCTCAGAGAACCTTCG

Xho Tet reverse

CCGGCTCGAGGATATGTTCTGCCAAGGGTT


Bauman and Kuehn BMC Microbiology 2009 9:26   doi:10.1186/1471-2180-9-26

Open Data