Table 1

Oligonucleotide probes included in the final microarray layout.

Targeted bacteria

Sequence (5'->3')

Length

Tm (°C)


Acinetobacter baumannii

AGTGTTTCAGATAATGGCC

19

47


AATTATTGTCACGATTCACGAGG

23

52



Enterococcus faecalis

CTGGTATCCCAACAGTAGAAGTA (parE)

23

53



Enterococcus faecium

TATCACCGTTATTGACGACGGTC

23

55


GGATACCTGTAGATATCCAGGCA

23

55



Haemophilus influenzae

GGCCATTGTTCCGATATTATCG

22

53


GTTCCGATATTATCGTGACAA

21

49



Klebsiella pneumoniae

TACTGCAAAGATATCGTTGTCA

22

49



Listeria monocytogenes

TACAATCGAAGCTGATAACAGCA

23

52


ACTGTTCGTGATAACGGACGTGG

23

57


GGTCGTCCAACAGTAGAAGT

20

52



Neisseria meningitidis

AATCACGGTAACGATACACGC

21

52



Staphylococcus aureus

CTGTCGAAGTTATTTTAACTGTTT

24

49


AATAGTATCGATGAAGCATTAGCTG

25

53



Staphylococcus epidermidis

TAGTCATATTGAAGTTRTAATTGAG

25

48–49


CATTAGCAGGTTATGCTAGTCATA

24

52



CNS

TCAACTTCAGAAAAAGGTTTACA

23

48


CGCCCAGCAGTTGAAGTTATCT

22

55



Streptococcus agalactiae

TTACATTGAACCAGATAACTCTA

23

48


TGGAAGACCAGCTGTAGAGACAG

23

57



Streptococcus pneumoniae

TGGTGATCGTATTGATGTAACTA (parE)

23

50



Streptococcus pyogenes

GTCCCGCCGTTGAAACAGTT

20

54


TTTTTACAGTCTTACACGCAGGT

23

52


GCAGGTTTTGCCTCTCATATTAAAGTCTT

29

57



mecA

TGATTATGGCTCAGGTACTGC

21

52


TGGCTCAGGTACTGCTATCCA

21

54


ATTAGCACTTGTAAGCACACC

21

50


TACTGCTATCCACCCTCAAAC

21

52


If not otherwise stated, the presented sequence targets the gyrB gene.

Melting temperature (Tm, basic) is calculated using software available at http://www.basic.northwestern.edu/biotools/oligocalc.html webcite.

Järvinen et al. BMC Microbiology 2009 9:161   doi:10.1186/1471-2180-9-161

Open Data