Table 1

Primers

Name

Sequence


dpsF

5'AATCTAGACTCGCTACTTTTCCTCTACACC3'

dpsR

5'AACATATGTTCATATCCTCTTGATGTTATGTCC3'

gadAF

5'AATCTAGATTTGATCGCCCGAACAGCAATG3'

gadAR

5'AACATATGGAACTCCTTAAATTTATTTGAAGGC3'

katEF

5'AATCTAGACTGTAGTTTAGCCGATTTAGCC3'

katER

5'AACATATGACTCGTCTCCTTAATTTATTACTG3'

osmEF

5'AATCTAGACCTTAAAGCTAACCCGTTGCTACTG3'

osmER

5'AACATATGCCGTCCTCTTGTTTATCAGCGTGTTAG3'

rpoSF

5'AAAAGCTTGCGCAACAATATTCAGGCACCATACG3'

rpoSR

5'AACATATGAGGTGGCTCCTACCCGTGATCCC3'


Roostalu et al. BMC Microbiology 2008 8:68   doi:10.1186/1471-2180-8-68

Open Data