Table 1

List of probes used in this study

Specificity

Name

E. coli Pos.

Sequence [5' – 3']

Length bases

Tm°C

GC %

Ref.


Ab. baumannii

aba1

64

CAAGCTACCTTCCCCCGCT

19

60.3

63

this

aba2

453

GTAACGTCCACTATCTCTAGGTATTAACTAAAGTAG

36

59.1

36

work

aba4

1132

GCAGTATCCTTAAAGTTCCCATCCGAAAT

29

60.8

41

"

Ab. johnsonii

ajo2

620

TCCCAGTATCGAATGCAATTCCTAAGTT

28

60.1

39

"

ajo3

979

GAAAGTTCTTACTATGTCAAGACCAGGTAAG

31

58.8

39

"

ajo4

1114

CTTAACCCGCTGGCAAATAAGGAAAA

26

60

42

"

Ab. lwoffii

alw1

133

GAGATGTTGTCCCCCACTAATAGGC

25

60.4

52

"

alw2

577

TGACTTAATTGGCCACCTACGCG

23

61

52

"

alw3

637

CCCATACTCTAGCCAACCAGTATCG

25

59.9

52

"

Ab.

ara1

78

CGCTGAATCCAGTAGCAAGCTAC

23

59.1

52

"

radioresistens

ara2

450

GTCCACTATCCTAAAGTATTAATCTAGGTAGCCT

34

60.3

38

"

ara3

1115

CCGAAGTGCTGGCAAATAAGGAAA

24

59.8

46

"

Cb. freundii

cif1

62

GCTCCTCTGCTACCGTTCG

19

58.2

63

"

cif2

442

CCACAACGCCTTCCTCCTCG

20

61.1

65

"

cif3

472

TCTGCGAGTAACGTCAATCGCTG

23

60.7

52

"

Cb. koseri

cik1

469

CGGGTAACGTCAATTGCTGTGG

22

59.9

55

"

cik2

639

CGAGACTCAAGCCTGCCAGTAT

22

60

55

"

Eb. cloacae

ecl4

471

GCGGGTAACGTCAATTGCTGC

21

60.6

57

"

ecl6

643

CTACAAGACTCCAGCCTGCCA

21

60

57

"

ecl7

652

TACCCCCCTCTACAAGACTCCA

22

60

55

"

Eb. aerogenes

ena2

444

GGTTATTAACCTTAACGCCTTCCTCCT

27

60.2

44

"

ena3

453

CAATCGCCAAGGTTATTAACCTTAACGC

28

60.4

43

"

ena4

473

TCTGCGAGTAACGTCAATCGCC

22

60.8

55

"

K. pneumoniae

kpn1

61

GCTCTCTGTGCTACCGCTCG

20

60.7

65

"

kpn2

203

GCATGAGGCCCGAAGGTC

18

58.9

67

"

K. oxytoca

klo1

81

TCGTCACCCGAGAGCAAGC

19

60.5

63

"

klo2

633

CCAGCCTGCCAGTTTCGAATG

21

60

57

"

E. coli

eco2

448

GTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCC

40

61.9

40

31

eco3

994

CCGAAGGCACATTCTCATCTCTGAAAACTTCCGTGGATG

39

65.6

49

31

M. morganii

mom2

121

GCCATCAGGCAGATCCCCATAC

22

60.9

59

this

mom3

440

CTTGACACCTTCCTCCCGACT

21

59.7

57

work

mom4

581

CATCTGACTCAATCAACCGCCTG

23

59.4

52

"

P. mirabilis

pmi3

247

GTCAGCCTTTACCCCACCTACTAG

24

59.8

54

"

pmi4

444

GGGTATTAACCTTATCACCTTCCTCCC

27

60

48

"

pmi5

625

CCAACCAGTTTCAGATGCAATTCCC

25

60.4

48

"

pmi6

820

GTTCAAGACCACAACCTCTAAATCGAC

27

59.3

44

"

P. vulgaris

pvu2

179

CTGCTTTGGTCCGTAGACGTCA

22

60.3

55

"

pvu4

1010

TTCCCGAAGGCACTCCTCTATCTCTA

26

61.9

50

"

Pm. aerogenes

psa4

585

GATTTCACATCCAACTTGCTGAACCA

26

59.9

42

"

psa5

1136

TCTCCTTAGAGTGCCCACCCG

21

61.7

62

"

psa6

1245

CGTGGTAACCGTCCCCCTTG

20

61

65

"

Sr. marcescens

sem1

62

CTCCCCTGTGCTACCGCTC

19

60.4

68

"

sem2

439

CACCACCTTCCTCCTCGCTG

20

60.7

65

"

sem3

460

GAGTAACGTCAATTGATGAGCGTATTAAGC

30

59.8

40

"

Sm. maltophilia

sma1

713

AGCTGCCTTCGCCATGGATGTTC

23

63.7

57

"

sma3

1265

TGGGATTGGCTTACCGTCGC

20

61

60

"

S. pneumoniae

spn1

56

CTCCTCCTTCAGCGTTCTACTTGC

24

60.7

54

"

spn3

201

GGTCCATCTGGTAGTGATGCAAGTG

25

60.9

52

"

spn5

634

TCTTGCACTCAAGTTAAACAGTTTCCAAAG

30

60.1

37

"

S. pyogenes

spy1

175

ATTACTAACATGCGTTAGTCTCTCTTATGCG

31

60.2

39

"

spy2

471

CTGGTTAGTTACCGTCACTTGGTGG

25

60.8

52

"

spy3

623

TTCTCCAGTTTCCAAAGCGTACATTG

26

59.6

42

"

Ec. faecium

efa1

67

CAAGCTCCGGTGGAAAAAGAAGC

23

60.3

52

"

efa2

208

CATCCATCAGCGACACCCGA

20

60.4

60

"

efa3

1240

ACTTCGCAACTCGTTGTACTTCCC

24

60.8

50

"

efa42

446

CCGTCAAGGGATGAACAGTTACTCTCATCCTTGTTCTTC

39

66.8

46

31

efa43

1242

ATTAGCTTAGCCTCGCGACTTCGCAACTCGTTGTACTTC

39

69.3

49

31

efa51

65

CTCCGGTGGAAAAAGAAGCGT

21

59

52

this

efa52

82

CTCCCGGTGGAGCAAG

16

57

52

work

Staphylococcus

sta1

995

CTCTATCTCTAGAGCGGTCAAAGGAT

26

59

46

"

sta2

1137

CAGTCAACCTAGAGTGCCCAACT

23

60

52

"

sta3

1237

AGCTGCCCTTTGTATTGTCCATT

23

59

44

"

sta4

1264

ATGGGATTTGCATGACCTCGCG

22

62

55

"

Sta. aureus

sar1

186

CCGTCTTTCACTTTTGAACCATGC

24

59

46

"

sar2

230

AGCTAATGCAGCGCGGATC

19

59

58

"

sar3

447

TGCACAGTTACTTACACATATGTTCTT

27

57

33

"

Sta. epidermidis

sep1

1005

AAGGGGAAAACTCTATCTCTAGAGGG

26

59

46

"

sep2

983

GGGTCAGAGGATGTCAAGATTTGG

24

59

50

"

sep3

993

ATCTCTAGAGGGGTCAGAGGATGT

24

60

50

"

Ec. faecalis

efc1

84

CCACTCCTCTTTCCAATTGAGTGCA

24

61

50

"

efc2

176

GCCATGCGGCATAAACTGTTATGC

24

61

50

"

efc3

193

CCCGAAAGCGCCTTTCACTCTT

22

62

55

"

efc4

452

GGACGTTCAGTTACTAACGTCCTTG

25

59

48

"

C. albicans

cal1

-

CCAGCGAGTATAAGCCTTGGCC

22

61.2

59

62

C. parapsilosis

cpa1

-

TAGCCTTTTTGGCGAACCAGG

21

60.6

52

62


List of probes used in this study including their nucleotide sequences and some characteristics. Abbreviations: Ab: Acinetobacter, Cb: Citrobacter, Eb: Enterobacter, Ec: Enterococcus, E: Escherichia, K: Klebsiella, M: Morganella, P: Proteus, Pm: Pseudomonas, Sr: Serratia, Sm: Stenotrophomonas, S: Streptococcus, Sta: Staphylococcus, C: Candida

Wiesinger-Mayr et al. BMC Microbiology 2007 7:78   doi:10.1186/1471-2180-7-78

Open Data