Table 1

Oligonucleotide primers used for module jumping and amplifications

Primer

Sequence (5'-3')

Use


F_C3a

GCA(CT)CA(CT)AT(ACT)AT(ACT)TC(AGCT)GA(CT)GG(AGCT)TGG

Module jumping (C-A domain)

R_T1a

C(AGT)A(GT)(AGT)A(AG)(AT)GA(AG)TG(ACT)CC(AC)CC

Module jumping (A-T domain)

F_A3

GG(ACT)(AT)C(AGT)AC(ACT)GG(ACT)(AC)A(AGCT)CC(ACT)AA(AG)GG

Module jumping (A-T domain)

PL10987_R2

CCGTTATCAGCAATAGTCCTA

Primer derived from pBc10987

PL10987_R4

GAATATACTCAACAGTAGCTACC

Primer derived from pBc10987

PL10987_R5

CGATACGTCAAATGTACTCGG

Primer derived from pBc10987

PL10987_R6

GTGATTCATATTGTCTGGATACG

Primer derived from pBc10987

PL10987_F20

GAAGAGAGATATGTCTGTACT

Primer derived from pBc10987

PL10987_F21

GTATATTGTGGCAATTGATGAAGC

Primer derived from pBc10987


a) see reference [22]. Primers for hybridization studies are provided in the supplement (see additional file Table S1); primers for inverse PCR and control sequence reaction are not shown

Ehling-Schulz et al. BMC Microbiology 2006 6:20   doi:10.1186/1471-2180-6-20

Open Data