Table 1

Sequence characteristics of primers developed in this study.

Name

Sequence (5' to 3')

Nomenclature

Bases

Tm


NSA3

AAACTCTGTCGTGCTGGGGATA

nu-SSU-1543-5'

22

67

NSI1

GATTGAATGGCTTAGTGAGG

nu-SSU-1671-5'

20

59

58A1F

GCATCGATGAAGAACGC

nu-5.8S-2206-3'

17

61

58A2F

ATCGATGAAGAACGCAG

nu-5.8S-2208-3'

17

57

58A2R

CTGCGTTCTTCATCGAT

nu-5.8S-2192-5'

17

57

NLB3

GGATTCTCACCCTCTATGA

nu-LSU-2754-5'

19

56

NLB4

GGATTCTCACCCTCTATGAC

nu-LSU-2755-5'

20

57

NLC2

GAGCTGCATTCCCAAACAACTC

nu-LSU-2821-5'

22

67

Plant control primers

NSIP

GATTGAATGATCCGGTGAAG

PC-nu-SSU-1671-5'

20

62

NLBP

GCTGTCACCCTCTCAGGC

PC-nu-LSU-2755-5'

18

64


Sequences are all listed 5' to 3' for the oligonucleotides. Nomenclature after Gargas and DePriest [23] as extended in this study. Tm is calculated by nearest neighbour method as an on-line service provided by Sigma-Genosys (The Woodlands, TX).

Martin and Rygiewicz BMC Microbiology 2005 5:28   doi:10.1186/1471-2180-5-28

Open Data