Table 3

Primers used for targeted gene deletions
Primer name Sequence 5′-3′ Purpose
pyrGN2 CACATGCCTCATTTTGACCA Mutant confirmation
PyrtpsAup ACCGTTGGAAGGTGGGATCCTATGGATCTCAGAA Amplifies pyrG with 3' tpsA overhangs
PyrtpsAdown CCTTTCAGAATGAGTGTGAGCGGATAACAATTTC
tpsAup CCATCTGTCTAGCTCTTCATCCCC tpsA, upstream fragment
tpsApyrup GATCCATAGGATCCCACCTTCCAACGGTGTAGAGACTCC
tpsApyrdown TTATCCGCTCACACTCATTCTGAAAGGTGGGGTTTTC tpsA, downstream fragment
tpsAdown GCAAGATTCCCGCATCCATC
tpsAupN1 CAACCCCACCAGTTCTCTCAAG Amplification of KO-fragment
tpsAdownN1 AAAGGGAGTTCCAAGCAGCCTG
pyrtpsBup* ATCTGCTCTGCCTGGGATCCTATGGATCTCAGAA Amplifies pyrG with 3′ tpsB overhangs
pyrtpsBdown CTGCCCATCACCATGTGAGCGGATAACAATTTC
tpsBup* TTGAACCCTTGAAACCGAACAC tpsB, upstream fragment
tpsBpyrGup* GATCCATAGGATCCCAGGCAGAGCAGATACTTACCCGTC
tpsBpyrGdown TTATCCGCTCACATGGTGATGGGCAGACGATTG tpsB, downstream fragment
tpsBdown TGCTAAAGAGGGTGTGGGATTG
tpsBupN3 TCCCGATTGGTAGAATCCCTAAAG Amplification of tpsB KO-fragment
tpsBdownN3 CATGCGAAAATGACAGGAACATTC
pyrGuphind TAAAAGCTTCTATATTGATCCTTA pyrG, KO of tpsC
pyrGdown TGTGAGCGGATAACAATTTC
tpsCupN-2 TGCCGAATTGACGTGCGTAGAG Cloning of tpsC
tpsCdownN-2 TGGTGGTGAACCTTTCGTTGTTC
tpsCupN5 CCCTCCATACTTACTCCATACATCTCG Amplification of tpsC KO-fragment
tpsCdownN5 CCAGCTTGACACATCCAACATAAC
pyrtppAup CCTGTCCCCGCTTCAAGAAAGGGATCCTATGGATCTCAGAA pyrG with 3′ tppA overhangs
pyrtppAdown GAGTCATCAGTGCTGCTTTCTGCTGTGAGCGGATAACAATTTC
TppAup TGTTGGAAGCGTCTTTCTGCC tppA, upstream fragment
tppApyrup TTCTGAGATCCATAGGATCCCTTTCTTGAAGCGGGGACAGG
tppApyrdown GAAATTGTTATCCGCTCACAGCAGAAAGCAGCACTGATGACTC tppA, downstream fragment
tppAdown TGTCCGATTGGGGGTGATTG
tppAupN1 TGAGGAGGCGTTGTCAAAAGATAG Amplification of tppA KO-fragment
tppAdownN1 CGATTGGGGGTGATTGGCTTAC
pyrtppBup CGGTAGGTTAGGGATCCTATGGATCTCAGAA Amplification of A. oryzae pyrG with 3′ tppB overhangs
pyrtppBdown GTTTGTCTTGTGTGAGCGGATAACAATTTC
tppBup ATACCAAGCAATCGCCCAAGCCAG tppB, upstream fragment
tppBpyrGup TCCATAGGATCCCTAACCTACCGCCCAAAGAGAGAGC
tppBpyrGdown TTGTTATCCGCTCACACAAGACAAACGATGCGGAATG tppB, downstream fragment
tppBdown CGTATCCTGGACTTTCAGCACG
tppBupN1 TTTTCGACCTTGGTGGGTGCTTCC Amplification of tppB KO-fragment
tppBdownN1 GAGACATTGTCGGTCAGTGAGGTAG
pyrtppCup TGTCCTTCAGGGATCCTATGGATCTCAGAA pyrG with 3′ tppC overhangs
pyrtppCdown* CTGTTCAGCATTGTGAGCGGATAACAATTTC
tppCup ATGAGGTGATAGTCGTGGACCCAG tppC, upstream fragment
tppCpyrup TCCATAGGATCCCTGAAGGACAAAGACAGGCTGAAG
tppCpyrdown* TTGTTATCCGCTCACAATGCTGAACAGATGATCCCCAG tppC, downstream fragment
tppCdown* TCGAGGTAGAGGTTCCCTTTCG
tppCupN1* CGATAGTCTTTGCGAACAGACGG Amplification of tppC KO-fragment
tppCdownN1* CGAGGTAGAGGTTCCCTTTCGATG
tpsBupN1 CCCTTTCCCGATTGGTAGAATC Amplification of tpsB/tppC double mutant

*Also used in the design of the tpsB/tppC double mutant.

Svanström et al.

Svanström et al. BMC Microbiology 2014 14:90   doi:10.1186/1471-2180-14-90

Open Data