Table 2

The sequences of the primers used for gene expression
Primer Sequences (5′-3′)
LACDP723R CAAACGTAGTGACCCTGAAGC
LACDP652F CTCGGAGAATGCCAGATGTT
rtBtubTRICHOR2 AGCGAATCCGACCATGAAGA
rtBtubTRICHOF2 CACCGTCGTTGAGCCCTA

Popiel et al.

Popiel et al. BMC Microbiology 2014 14:82   doi:10.1186/1471-2180-14-82

Open Data