Table 3

Strains, cells, plasmids and primers used for this study
Strain, cell, plasmid, primer Relevant description/sequence Reference or source
Strains
V. cholerae
 MO10 pG13 O139 containing pG13 This study
 N16961 Wild type, O1, El Tor, Inaba Makassar (1971), clinical isolate [8]
 NM06-058 Wild type, O1, El Tor, Ogawa Kolkata (1996), clinical isolate
 NM06-058 T283M Contains a point mutation in gene VC_A0531 on AA position 283 This study
RKI-ZBS2-A310-3 Isolate, O1, El Tor, Inaba RKI
RKI-ZBS2-A310-12 Isolate, O1, El Tor, Ogawa RKI
RKI-ZBS2-A198-1 Isolate, O1, El Tor, Ogawa RKI
RKI-ZBS2-A310-25 Isolate, O139, El Tor RKI
RKI-ZBS2-A186-9 Isolate, O139, El Tor RKI
RKI-ZBS2-186-10 Isolate, O139, El Tor RKI
RKI-ZBS2-A220-1 Isolate, Non O1/O139 RKI
RKI-ZBS2-A222-1 Isolate, Non O1/O139 RKI
RKI-ZBS2-A227-1 Isolate, Non O1/O139 RKI
Gram-negative
Acinetobacter baumannii ATCC 30007 DSMZ
E. coli ESBL, 5044257621-1 HZI
E. coli ETEC NICED
E. coli S17-1 HZI
Klebsiella pneumoniae 50219455 HZI
Pseudomonas aeruginosa 90013687 HZI
Salmonella typhimurium NICED
Shigella boydii NICED
Shigella flexneri NICED
Gram-positive
Enterococcus faecalis ATCC 20212 HZI
Staphylococcus aureus MRSA, N315 HZI
Cell line
 L929 Mouse fibroblastic cell line Derived from commercial source, DSMZ: ACC 2
Plasmid
 pG13 Plasmid containing the constitutive expressing G13 promoter- and gfp-gene sequence, ligated in pFPV27 vector, (Kmr) [9]
 pEX18Ap Plasmid containing Ampr gene β-lactamase, the sacB gene encoding the levansucrase HZI
Oligonucleotide primer
 VC_A0531_forw2 TCACGAACCAACAGGATTAAG Used for colony PCR and sequencing of the products
 VC_A0531_rev2 CGGTTAAAGTGGTAGCAGAG Same as above
 Mut_forw_1 ACATCATCTAGAGCAGCAGCAACACAAGA (XbaI) Used for generation of the point mutation
 Mut_rev_1 ATCGCGCCAAGCGGCATTTTTAGATCG Same as above
 Mut_forw_2 CGATCTAAAAATGCCGCTTGGCGCGAT Same as above
 Mut_rev_2 ACATCAAAGCTTAACATGCGCCACCAGAC (HindIII) Same as above
kdpD_del_forw_1 ACATCATCTAGAGGAATCCATCAAAGAAA (XbaI) Used for generation of the deletion mutation of kdpD
kdpD_del_rev_1 ACAGGATTAAGAAGCAATGAACAGTGAAATTAAGATCCTC Same as above
kdpD_del_forw_2 GAGGATCTTAATTTCACTGTTCATTGCTTCTTAATCCTGT Same as above
kdpD_del_rev_2 ACATCACTGCAGAACACAAGATCCAACAC (PstI) Same as above

Sergeev et al.

Sergeev et al. BMC Microbiology 2014 14:49   doi:10.1186/1471-2180-14-49

Open Data