Table 2

Primers used in this study
Primers Sequencea Restriction site
Primers for mutagenesis of ureA
ureA-UF 5′ GCTCTAGAATCCTTCATGGGCTGT XbaI
ureA-UR 5′ GCAGGGAGCGGTGGATAACCTCCATTTG
ureA-DF 5′ TGGAGGTTATCCACCGCTCCCTGCACAC
ureA-DR 5′ CGCATGCTTCCTCATCAGATGGAGCAGACG SphI
Inner-ureA-F 5′ TGCATCTCACTCCGCGTGAG
Inner-ureA-R 5′ TACTGGATCGGGGAATGCAC
Primers for mutagenesis of ureC
ureC-UF 5′ TCAGAGCTCCAGGTCGAAGCCGTCTTCAC SacI
ureC-UR 5′ GTTTCCGGGTTACCCAGACGGATCTTG
ureC-DF 5′ TCCGTCTGGGTAACCCGGAAACCTTCG
ureC-DR 5′ TCGTCGACCGTTGGCCACGAAGATGTCC SalI
Inner-ureC-F 5′ GTCCGTCCGGAAACCATTGC
Inner-ureC-R 5′ CCTGCGAGGCAAAGGTGATG
Primers for mutagenesis of ureD
ureD-UF 5′ GCGAGCTCCAAGACCGCCATCATCGAAG SacI
ureD-UR 5′ GGTACATCAGGTCAAACGCGGCGATGGC
ureD-DF 5′ CGCGTTTGACCTGATGTACCGGGTGGTG
ureD-DR 5′ GCGTCGACACCAGATACAGCCACATCAG SalI
Inner-ureD-F 5′ TACAGCAGGCGCTGTACTGG
Inner-ureD-R 5′ GCAGCAGCACGTTGGCAAAG
Primers for mutagenesis of ureE
ureE-UF 5′ CGTCTAGAGGAGCCATGTTCCGCGAAT XbaI
ureE-UR 5′ GCATGGTGATGCAGGGCAATCTCCACT
ureE-DF 5′ AGATTGCCCTGCATCACCATGCGGAAG
ureE-DR 5′ TGCATGCCATCATCGAGGCCAGTCC SphI
Inner-ureE-F 5′ TGGCCAGCATCACGCTCAAG
Inner-ureE-R 5′ TGCAGGTGCTGGTGGGTATG
Primers for mutagenesis of arcA1
LPW14961 (arcA1-UF) 5′ CCGCTCGAGTGGATGATCACGGTCAAG XhoI
LPW14962 (arcA1-UR) 5′ GTATTGCGGTCCTGTTCAACCCAGATCAC
LPW14963 (arcA1-DF) 5′ GGTTGAACAGGACCGCAATACCTATACC
LPW14964 (arcA1-DR) 5′ CTAGTCTAGATAGCGGGCCAGCTCTTCG XbaI
LPW16076b (Inner-arcA1-F) 5′ ACATGCTGACCAGGGTTTG
LPW16077b (Inner-arcA1-R) 5′ AAAGGCTTGTCGTGCCGTTC
Primers for mutagenesis of arcA2
LPW14965 (arcA2-UF) 5′ CCGCTCGAGGATTTATTCGCCGGAAAC XhoI
LPW14966 (arcA2-UR) 5′ ACACCGCGATCGTAGTCGTGGTCCTTCTG
LPW14967 (arcA2-DF) 5′ CACGACTACGATCGCGGTGTTGAAGTG
LPW14968 (arcA2-DR) 5′ TGCTCTAGAGTACATGCGGCCCAGAAC XbaI
LPW16078c (Inner-arcA2-F) 5′ ATCGCAAGGTGTGCGCCAAC
LPW16079c (Inner-arcA2-R) 5′ AGCGATTCACGCACCACTTC
Primers for real-time qPCR
LPW21629 (arcA1-F) 5′GTCACCCTCAATCCGATG
LPW21630 (arcA1-R) 5′CACCACACCTTCACCTTG
LPW21631 (arcA2-F) 5′CCGAAGTGGTGCGTGAATC
LPW21632 (arcA2-R) 5′TCTTGTTGGTGTAGGTGTTGC
LPW21635 (rpoB-F) 5′GTGCTGTTCGTCAATGAG
LPW21636 (rpoB-R) 5′TAGGTCGTAGGATTCTTCG
LPW22260 (ureA-F) 5′ATCTATTGCCTCGCCGAAGTG
LPW22261 (ureA-R) 5′AGTGCTGCCGCCGAAATC

aRestriction sites in the primer sequences are in italic.

bSpecific primers for amplification of arcA1.

cSpecific primers for amplification of arcA2.

Xiong et al.

Xiong et al. BMC Microbiology 2014 14:42   doi:10.1186/1471-2180-14-42

Open Data