Table 1

Sequences of the primers used
Primer name Type Sequence (5' → 3')
F3 Forward outer CAACAGCAACCCTTGGGA
B3 Backward outer GGACAGTACCATTGACAGCA
FIP Forward inner prime (F1C-TTTT-F2) GCGTCCTTAACAAGGACAGGGTTTTTGTCGGGTCAAACACCAGTG
BIP Backward inner primer (B1C-TTTT-B2) GTGCAGGCGTTAGGTGCACATTTTTGCGCCAACCATAGAGGTTA

Yang et al.

Yang et al. BMC Microbiology 2014 14:38   doi:10.1186/1471-2180-14-38

Open Data