Table 1

Sequences of primers and probes utilized in the study
Amplification Oligonucleotide Sequence 5′ - 3′ Origin Target sequences
I *EXT_BAC_F kGCGrACGGGTGAGTAA in this study 16S rRNA
*EXT_BAC_R CGCATTTCACCGCTA in this study
*EXT_FUN_F AATTGACGGAAGGGCACC in this study 18S rRNA
*EXT_FUN_R TTCCTCGTTGAAGAGCAA in this study
II **FUN_F TTGGTGGAGTGATTTGTCTGCT [11] 18S rRNA
**FUN_R TCTAAGGGCATCACAGACCTG
Candid_probe FAM-TTAACCTACTAAATAGTGCTGCTAGC-BHQ1
Asperg_probe TexasRed-TCGGCCCTTAAATAGCCCGGTCCGC-Eclipse
**GN/GP_F GACTCCTACGGGAGGC [10] 16S rRNA
**GN/GP_R GCGGCTGCTGGCAC
GP_Probe Hex- CTGAyssAGCAACGCCGCG –TAMRA (Q)
GN_Probe Cy5 –CCTGAysCAGCmATGCCGCG- BHQ-2
β-actin gene F GCCAGTGCCAGAAGAGCCAA [16] β-actin gene
R TTAGGGTTGCCCATAACAGC

*External primers; **internal primers; k = G/T; r = A/G.

Gosiewski et al.

Gosiewski et al. BMC Microbiology 2014 14:144   doi:10.1186/1471-2180-14-144

Open Data