Table 3

Primers used in this study to target 16S r RNA genes of total archaea and the novel RCC species, mcrA genes of methanogens
Target Primers Sequence (5’-3’) Annealing temp (°C) References
Archaea* 915f 1386r GTGCTCCCCCGCCAATTCCT GCGGTGTGTGCAAGGAGC 59 [11]
Methanogen 86f GCTCAGTAACACGTGG 56 [2]
1340r CGGTGTGTGCAAGGAG
The novel RCC species* 178f TGGGATCTGGAATGACCCATGG 56 This study
434r TGAGAAAAGCTAGAACAAATGTCCT
Methanogen 519f CAGCCGCCGCGGTAA 57 [39]
915r# CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCG
Methanogen (mcrA gene) MLf GGTGGTGTMGGATTCACACARTAYGCWACAGC 55 [40]
MLr TTCATTGCRTAGTTWGGRTAGTT

*, For real-time PCR; , For DGGE; #, Where the primer name is prefaced by ‘GC-’ in the text, a GC-clamp was added to the 5’.

-terminus of the primer. The GC-clamp sequence was CCCCGTGCTCCCCCGCCAATTCCT;.

Jin et al.

Jin et al. BMC Microbiology 2014 14:104   doi:10.1186/1471-2180-14-104

Open Data