Table 2

Primers used in this study
Primer Sequence Application Amplicon size
A7F 5′- GGATTTGGGATACCGCTCTT -3′ gerA detection/sequencing 718 bp
A7R 5′- TGCAGATGCTGCGAGAATAC -3′ gerA detection/sequencing 718 bp
gerAAF MW3 5′- CCCTGTTCCTATCGGCGTTT -3′ RT-PCR (E = 2.01) 59 bp
gerAAR MW3 5′- TCGGCAGCATGCCTTGA -3′ RT-PCR (E = 2.01) 59 bp
gerAAF 1112/1032/800 5′- CGCCGTTCCCACAGATTC –3′ RT-PCR (E = 2.01/1.98/1.95) 55 bp
gerAAR 1112/1032/800 5′- CAGCGCTGAAGAAACCTTGTC –3′ RT-PCR (E = 2.01/1.98/1.95) 55 bp
rpoBF 5′- ACCTCTTCTTATCAGTGGTTTCTTGAT -3′ RT-PCR (E = 2.00) 70 bp
rpoBR 5′- CCTCAATTGGCGATATGTCTTG -3′ RT-PCR (E = 2.00) 70 bp

Madslien et al.

Madslien et al. BMC Microbiology 2014 14:101   doi:10.1186/1471-2180-14-101

Open Data