Table 4

List of primers used for qRT-PCR
Namea Strainb Sequence
5RTagaA EDL933 CCGTTTCTCAGCACACCTTA
3RTagaA EDL933 CCCAGCATCACTCGTACATT
5RTnagA EDL933 TTACCTTTGCCACCCATCTG
3RTnagA EDL933 GCAGGCCATCAGCGATAATA
5RTnagB EDL933 ATCTGTTTATGGGCGGTGTAG
3RTnagB EDL933 GAGTGTCATGAGTCAGGGTTT
5RTagaA E. coli C ACTTCACGCCGCAGAATAA
3RTagaA E. coli C GCTGAGAAACGGCAATCAAC
5RTagaR E. coli C ACGGTATGAACGTGGCTAATG
3RTagaR E. coli C CAGCCTGATCGCCGTAAA
5RTagaS Both ATCCGCTGCTGTTGATCTC
3RTagaS Both GGTGATAGCATTCCGGTACAA
5RTnagA E. coli C CCGTGGCTGAATCTGGTAAA
3RTnagA E. coli C ATGACGTCGGCGTTCTTAC
5RTnagB E. coli C ATCTGTTTATGGGCGGTGTAG
3RTnagB E. coli C GAGTGTCATGAGTCAGGGTTT
5RTgapA Both CGACCTGTTAGACGCTGATTAC
3RTgapA Both CGATCAGATGACCGTCTTTCAC

a The primer names indicate the genes that are targeted for quantification of transcript. The number, 5 preceding the name of the gene indicate forward primers and the number, 3 preceding the name of the gene indicates reverse primers.

b The strain name indicates the sequence used to design the primer was from that strain and when the same primer is used for both strains it is indicated as both.

Hu et al.

Hu et al. BMC Microbiology 2013 13:94   doi:10.1186/1471-2180-13-94

Open Data