Table 3

List of primers used for constructing and verifying gene knockouts and gene cloning
Namea Strainb Sequence (5' to 3')
Primers for gene knockouts
5agaA Both GGCGTTGATGTAATGGATGACGCGCCGGATGTACTCGACAATGGTGTAGGCTGGAGCTGCTTC
3agaA Both CTGCCGCATCAACAGACAGCGTACTGCCCGCCAG CCACCATTATTCCGGGGATCCGTCGACC
5nagA Both TAGCGGAACTGCCGCCAGAGATCGAACAACGTTCACTGAAAATGGTGTAGGCTGGAGCTGCTTC
3nagA Both AGGATGATATGTGGACCGGCAGCGACGATGTCGCTGCTTTATTATTCCGGGGATCCGTCGACC
5nagB Both AATCCGCCAACGGCTTACATTTTACTTATTGAGGTGAATAATGGTGTAGGCTGGAGCTGCTTC
3nagB Both AAATATTGCCCTGAGCAAGGAGCCAGGGCAGGGATAACAAATTATTCCGGGGATCCGTCGACC
5agaI Both TGTGCTCTCTATTGTTTGTTTCCGCATTCGGCATTTTGTAAATGGTGTAGGCTGGAGCTGCTTC
3agaI EDL933 ATAAGTTAATTTAAACATTTTGAGCAATTTTTCATCTGGATTATTCCGGGGATCCGTCGACC
3agaI E. coli C GGCGACCCGCGGTTTTTAACATCTCATGTTGCTGTGTTCTATTATTCCGGGGATCCGTCGACC
5agaS EDL933 TGCGGATCATCCTGACCGGAGCCGGAACCTCGGCATTTATATGGTGTAGGCTGGAGCTGCTTC
5agaS E. coli C CTGCGGATCATCCTGACCGGAGCCGGAACGTCGGCATTTATATGGTGTAGGCTGGAGCTGCTTC
3agaS Both AGGATGATATGTGGACCGGCAGCGACGATGTCGCTGCTTTATTATTCCGGGGATCCGTCGACC
5agaR E. coli C ACGCAGCGTTGCGAAAGCTGCCGTTGAGTTGATTCAGCCAATGGTGTAGGCTGGAGCTGCTTC
3agaR E. coli C CTGACGCCGCGCTCCAGATCGATCGCATCTACACCAAGAAATTATTCCGGGGATCCGTCGACC
Primers for PCR and sequencing for verification of gene knockouts
FagaA Both ATGACACACGTTCTGCGCGCCAG
RagaA Both TCAAAACGAAGCTAATTGACCCTG
FnagA Both ATGTGGACCATCAGCTGTCTGC
RnagA Both TTCTTTGATCAGCCCGCGTTCGA
FnagB EDL933 TATCGCAAATTAAACGAGTGTCT
RnagB Both GTTCAGTGAACGTTGTTCGATCTCT
FnagB E. coli C TATCGCAAATTAAACGCGTGTCT
RagaI Both TGACATTCGTTTGCCATCGACAGTAC
FagaI EDL933 GACTTTGCTGCGCCAGGGGGCGAGT
RagaI E. coli C TGAGCAAATTTTTCATCTGGTTAGG
FagaS Both CATCCAGCAATCCTTTTGCTTC
RagaS EDL933 TAGATCTCTTCCAGCGCGATATGTT
RagaS E. coli C TAGATCTCTTCCAGCGCGATGTGTT
FagaR E. coli C ATGAGTAATACCGACGCTTCAGGT
RagaR E. coli C ACCAGAATCACTTCAACCCCAGCC
Primers for cloning genes
5nagAHindIII Both GCATAAGCTTACATTTTACTTATTGAGGTGAATAATGTATGCATTAACCCAGGGCCGGATC
3nagASmaI Both GCATCCCGGGTTATTGAGTTACGACCTCGTTACCGTTAA
5agaAHindIII EDL933 GCATAAGCTTCAGTAATCTGAACTGGAGAGGAAAATGTCCGGTCGAGGAAGGGATATGACA
5agaAHindIII E. coli C GCATAAGCTTCAGTAATCTGAACTGGAGAGGAAAATGTCCGGTCGAGGAAGGAATATGACA
3agaAPstI Both GCATCTGCAGTCAAAACGAAGCTAATTGACCCTGAATCC
5agaIHindIII E. coli C GCATAAGCTTGTTCATCAGACTAAGGATTGAGTTATGGAACGAGGCACTGCGTCTGGTGG
3agaISmaI E. coli C GCATCCCGGGTTAAGGTGTTAATTAAACAAATAAAGTTC
5nagBHindIII E. coli C GCATAAGCTTACATTTTACTTATTGAGGTGAATA
3nagBSmaI E. coli C GCATCCCGGGTTACAGACCTTTGATATTTTCTGC
5agaSHindIII EDL933 GCATAAGCTTGTTCATCAGACTAAGGATTGAGTT
3agaSPst1 EDL933 GCATCTGCAGTTATGCCTGCCACGGATGAATGATTACGC
3agaYPst1 EDL933 GCATCTGCAGTTATGCTGAAATTCGAATTCGCTG
5agaSDHindIII E. coli C TAGCATAAGCTTATGCCAGAAAATTACACCCCT
3agaSDEcoR1 E. coli C TAGCATGAATTCTTACAAAATGCCGAATGCGGA
5agaBDHindIII E. coli C GCATAAGCTTGTTCATCAGACTAAGGATTGAGTTATGACCAGTCCAAATATTCTCTTAAC
3agaBDSmaI E. coli C GCATCCCGGGTTACAAAATGCCGAATGCGGAACAAACAA

a The primer names indicate the genes that are targeted for construction and verification of knockout mutants and for cloning. The number, 5, and the letter, F, preceding the name of the gene indicate forward primers and the number, 3, and letter, R, preceding the name of the gene indicates reverse primers. Restriction enzymes used for cloning a gene are stated in the primer name following the name of the gene.

b The strain name indicates the primer used for that particular strain and when the same primer is used for both strains it is indicated as both.

Hu et al.

Hu et al. BMC Microbiology 2013 13:94   doi:10.1186/1471-2180-13-94

Open Data