Table 2

Primers used in this study
Primer Sequence (5′ → 3′)
FRT-leftF AATCCATCTTGTTCAATCATGC
FRT-rightR AATTCGAGCTCGGGAAGATC
FRT-T7F AAATTAATACGACTCACTATAGG
FRT-SP6R TACGATTTAGGTGACACTATAG
Inv-pUC118F CAACGTCGTGACTGGGAAAAC
Inv-pUC118R TCATGGTCATAGCTGTTTCCTG
TetR-FLP2F CGATGGGTGGTTAACTCGAC
TetR-FLP2R ACAGGACGGGTGTGGTCG
AtaAupstF CGC
    GGATCC
GATCTTCAAAGGTTGTGCTCAG
AtaAupstF2 AACGCAAGTTGTTTTACTGC
AtaAupstR CGC
    GGATCC
TAGAAGCTGTAGCAGTTGTTCC
AtaAdwstF CGC
    GGATCC
ACTCGACAGGGAAGATCTTC
AtaAdwstR CGC
    GGATCC
AATTGAATCATCAACACCTGCTG
AtaAdwstR2 TACGTCGAGCAGCTAAGGTC

Underlines indicate BamHI site.

Ishikawa and Hori

Ishikawa and Hori BMC Microbiology 2013 13:86   doi:10.1186/1471-2180-13-86

Open Data