Table 2

Primers used for PCR
Primer Sequence (5-3)a Target/locationb Reference
acf-R1 TCCTCAGCATCCTTTTCTTCA acf This study
arsR-up1 TGTGGATCTATGGAATTGAGGA upstream of arsR This study
feoB-F1 ATGGTCTCCAAAAAGCATGA feoB This study
feoB-F2 AAGACAGGAACAAGCGAAACA feoB This study
feoB-R1 TGGGGCATTGATTACACTGA feoB This study
IRL-scc TATCRGWTRATGATGMGGTTT IRL of SCCmec [7]
IS2 TGAGGTTATTCAGATATTTCGATGT IS431 [31]
MecA147-F GTGAAGATATACCAAGTGATT mecA [30]
MecA147-R ATGCGCTATAGATTGAAAGGA mecA [30]
orf_1-F1 GAAATGAGCTGAAAGCACGA lip This study
Orf2_1-R1 TTGGAGGTTTCTCCCCATC orf24, a Putative multicopper oxidases gene This study
Orf24-1 CCAAATGAATTGTTAGACGTTG spacer between putP and IS431Δ This study
orfX-F1 GAAAAAGCACCWGAAAMTATGAG orfX [7]
SH0128-R1 TTTTGTGGTTGTGACGGTGT orf45, locus SH0128 in AP006716 This study
ZZ-3 GTGAGGTTGGTGGTGATAAAA spacer between putP and IS431Δ This study
ZZ-4 GCGGGTCCTTCTGGTATAGG FAD This study
ZZ-11 TATCTCGGGAAATCGATAAAAA spacer between IS431 and orf32 This study
ZZ-12 GTTGAAAGGAAACAAAAACTACG spacer between IS431 and orf32 This study
ZZ-16 CCGATAACGTCATTCCATCT orf32, ABC-type bacteriocin transporter gene This study
ZZ-24 AGCACGACAACAAAAGCATC orf33 This study
ZZ-28 TGGAGGAGGAGTTTTGGCTA orf35, chromate transporter This study
ZZ-29 TACGACATGACCACCTCCAA orf35, chromate transporter This study
ZZ-30 GTAGCTGTTGCCATTGTTGC orf35, chromate transporter This study
ZZ-31 GCTTGCAGGTCCAGGTAAAA orf35, chromate transporter This study
ZZ-32 TGGACGTATCGCTTCAAATG orf33 This study

a D: A, G or T; H: A, C or T: M: A or C; R: A or G; W: A or T; Y: C or T; V: A, C or G.

b More information about orfs listed here is available in Table 1.

Zong

Zong BMC Microbiology 2013 13:64   doi:10.1186/1471-2180-13-64

Open Data