Table 1

Primers targeting some metal-resistance genes used in this study
Primer name Mechanism involved/metal involved Sequence forward (5’-3’) Sequence reverse (5’-3’) Annealing temperature Amplicon size (bp)
copA Sequestration and transport/Cu TCCATACACTGGCACGGCAT TGGATCGGGTGAGTCATCAT 54 1331
copB Sequestration and transport/Cu TCCACGTTTGTTCACTGCTC AGTCGGCTGTATTGCCGTAG 53 900
copC Sequestration and transport/Cu TGTTGAACCGCACAAGTTTC GGTAATCGGGTGGGTATCG 54 350
cnrC2 RND (Efflux)/Co and Ni GAGGAAGCGCTGGATTCC GCAATTCCATCAAAGTTGTCTTGCC 55 341
cnrA3 RND (Efflux)/Co and Ni GGACATTACCAACAAGCAGG CACAAACGTCAGCGACAG 51.5 1447
chrB CHR transporter (efflux/reduction)/Cr GTCGTTAGCTTGCCAACATC CGGAAAGCAAGATGTCGATCG 57 450
czcD Cation diffusion facilitator (efflux)/Co, Zn and Cd

TTTAGATCTTTTACCACCATGGG

CGCAGGTCACTCACACGACC

TTTCAGCTGAACATCATACCCTAGTT

TCCTCTGCAGCAAGCGACTTC

57 1000
nccA RND (Efflux)/Ni, Co, Cd ACGCCGGACATCACGAACAAG CCAGCGCACCGAGACTCATCA 57 1141

Kamika and Momba

Kamika and Momba BMC Microbiology 2013 13:28   doi:10.1186/1471-2180-13-28

Open Data