Table 3

PCR primer pairs used for targeting invA gene for detection of Salmonella
Primer sequence (5′---3′) Type of PCR Position Length (bp) Reference (year)
GCTGCGCGCGAACGGCGAAG Conventional 586-608 389 Ferretti et al. (2001)
TCCCGGCAGAGTTCCCAT T 972-954
ACAGTGCTCGTTTACGACCT AAT Conventional 104-127 244 Chiu and Ou (1996)
AGACGACTGGTACTGATCGATAAT 347-324
GTGAAATAATCGCCACGTTCGGGCAA Conventional 371-396 285 Malorny and Hoorfar (2005)
TCATCGCACCGTCAAAGGAACC 655-634
GTGAAATAATCGCCACGTTCGGGCAA Conventional 371-396 285 Rahn et al. (1992) [28]
TCATCGCACCGTCAAAGGAACC6 655-634
AGTGCTCGTTTACGACCTGAA Conventional 106-126 229 Mainar-Jaime et. al. ( 2013) [29]
TGATCGATAATGCCAGACGA 334-315
ACAGTGCTCGTTTACGACC Conventional 104-122 1614 Banihashemi et al. (2012) [31]
TACGCACGGAAACACGTTC 1717-1699
TTTACGGTCTATTTTGATTTG Conventional 1350-1370 444 Arnold et al. (2004) [30]
ATATGCTCCACAAGGTTAATG 1703-1683
TTATTGGCGATAGCCTGG Real-time 401-418 33 ABI, (1999)
CGGTGGGTTTTGTTG 433-419
TTGGCGATAGCCTGGCGGTG Real-time 404-423 136 Braun et al. (2011) [35]
TGTTTACCGGGCATACCATCCAGAG 539-515
TCGTCATTCCATTACCTACC Real-time 167-186 119 Hoorfar et al. (2000) [33]
AAACGTTGAAAAACTGAGGA 285-266
GATTCTGGTACTAATGGTGATGATC Real-time 132-156 269 Liang et al. (2011) [34]
GCCAGGCTATCGCCAATAAC 419-400
GTGAAATAATCGCCACGTTCGGGCAA Real-time 371-396 285 Chen et al. (2011) [32]
TCATCGCACCGTCAAAGGAACC 655-634
CGTTTCCTGCGGTACTGTTAATT Real-time 281-303 130 This study
TCGCCAATAACGAATTGCCCGAAC 410-387

Li and Chen

Li and Chen BMC Microbiology 2013 13:273   doi:10.1186/1471-2180-13-273

Open Data