Table 1

Primers used in this study
Primer name Primer sequence gene (a)
Northern probes
Zfor AAAGTWATCGGTGTCGGCGGWGGC ftsZ +43
Zrev CAGAAATACCTTGAACCCCTTGGCG ftsZ +595
Ain GAACAGCAATGAAATATATGTTG ftsA +3
N2R ACCGTCTACAATGAACTGTC ftsA +411
Primer Extension
prex GCCCAAACCGCACTCGCAC ftsW +95
Wrev AATCCATTCTCTGTACCAATG murG +125
Rip2 GTTGCTTAGYAGCCAGTTTC murG +1030
Qrev TCTTTARCTTTGGTACACGATC ftsQ +52
Arev TCATTAACCATTTCACCAATGATG ftsA +80
N2R ACCGTCTACAATGAACTGTC ftsA +411
ZB CACCGTGTTCAATCATACGG ftsZ +103
ZD ACAACCAAACAACGTCGGCG spoIIGA +74
ZDbis CCTAACACAAGCCTCCATC spoIIGA +158
BigD CCCAAATGCTGTATACACAATAAGTAACGAG spoIIGA +273
RT-PCR
Zfin CTTTTATCGTCTACGACGGTTAC ftsZ +1158
Zin CATGTTAGAGTTTGATACTACTC ftsZ −1
Ain GAACAGCAATGAAATATATGTTG ftsA +3
Afin CCCATAAATAACGGAATGCACG ftsA +1297
Qin CGTACATGAARAAYAGTAARG ftsQ −5
Mbin GAGATTGTCTATGGAACAATTAG murB −10
MGin ACAGCTGAAACNCTTATTCGTG murG +964
Fw CATCAGCACCGTATCGRATG ftsW +601
Mini-ftsZ (b)
Hind5 GACAAGCTTATATTGGTGTTCGTGAG ftsA +1056
Eco5 GGCGAATTCGCTAATTGATCTTGAG ftsZ +39
Eco3 CACGAATTCAAAACAACGTGAAGTTAAG ftsZ +1035
Bam3 GGCGGATCCAAAAAGGAGCATGAAAGCTC spacer +28
Amy5 GCCGCGATTTCCAATGAGG pJPR1 +245

(a) Position of the primer 5’ nucleotide on the corresponding gene numbering beginning from the first codon of the gene (+1).

(b) Position on the gene of the first complementary primer base after the added restriction site evidenced bold.

Santini et al.

Santini et al. BMC Microbiology 2013 13:27   doi:10.1186/1471-2180-13-27

Open Data