Table 6

List of primers used in this study for PCR amplification and sequencing of the four CRISPR-MVLST markers
Primer Orientation Primer sequence (5′-3′) Annealing temp. PCR Sequencing
CRISPR1-5 Forward TGAAAACAGACGTATTCCGGTAGATT 55.5
CRISPR1-1 Reverse CAGCATATTGACAAGGCGCT
CRISPR2-3 Forward ATTGTTGCGATTATGTTGGT 57
CRISPR2-1 Reverse TCCAGCTCCCTTATGATTTT
CRISPR2-4 Reverse GCAATACCCTGATCCTTAACGCCA
CRISPR2-5 Reverse CGACGAAATTAAAACCGAACT
CRISPR2-6 Forward CGGATTCCATGCGTTTTCA
CRISPR2-7 Forward CCGGCGAGGTCAATAAAA
CRISPR2-8 Forward TGACGCTGGTCTATACCG
CRISPR2-9 Forward GTGACGTCAGTGCCGAA
CRISPR2-10 Reverse CTCTTCGCACTCTCGATCAA
fimH-1 Forward AGGTGAACTGTTCATCCAGTGG 56.7
fimH-2 Reverse GCGGGCTGAACAAAACACAA
sseL-1 Forward AAAATCAGGTCTATGCCTGATTTAATATATC 60
sseL-2 Reverse GGCTCTAAGTACTCACCATTACT
sseL-3 Forward ACCAGGAAACAGAGCAAAATGAATATATGT
sseL-4 Forward TTCTCTCGGTAAACTATCCTATTGGGC

Shariat et al.

Shariat et al. BMC Microbiology 2013 13:254   doi:10.1186/1471-2180-13-254

Open Data