Table 2

Primers used in this study
Primers for PCR and sequencing
Primer name Primer sequence (5′ → 3′) Target gene
IMP F GCATTGCTACCGCAGCAGAG blaIMP alleles
IMP R GGTTTAAYAAAACAACCAC
VIM F TCGGAGAGGTCCGACTTTACC blaVIM alleles
VIM R CCATTCAGCCAGATCGG
SPM-1 F ACGTTTTCGTCGTCACAG blaSPM-1 gene
SPM-1 R GTCCAGGTATAACAATTTTCG
NDM-1 F AATGGAATTGCCCAATATTATGC blaNDM-1 gene
NDM-1 R TCAGCGCAGCTTGTCGGC
OXA-23 F GATGTGTCATAGTATTCGTCG blaOXA-23 gene
OXA-23 R TCACAACAACTAAAAGCACTG
OXA SET A Fa ATGAAAAAATTTATACTTCC blaOXA-24-like alleles
OXA SET A R TTAAATGATTCCAAGATTTTC
OXA SET B F ACAGAARTATTTAAGTGGG blaOXA-51-like and blaOXA-58-like alleles
OXA SET B Ra GGTCTACAKCCMWTCCCCA
OXA SET C F ATGAAAACATTTGCCGCATA blaOXA-10-like alleles
OXA SET C R CGTTGTCTATATCCATGTTA
ISABA1 F GTGCTTTGCGCTCATCATGC ISAba1
ISABA1 R CATGTAAACCAATGCTCACC
ISABA1 F2b AGTTGCACTTGGTCGAATGA Detection of ISAba1 upstream blaOXA-51 and blaOXA-23
CARO F GCTCACCTGATGCTGACATT carO gene and its promoter
CARO R TTGCTTCTTCAACAGCTTGG
CARO F SQ GCGGCTTACCTTGATAACG carO gene sequencing
CARO R SQ TTACGAGCTTCCGCATTTAC
Primers for relative quantification
TR CARO F AGCTTTACTTGCTGCTGGTG A. baumannii carO transcription
TR CARO R CGAGCGCCTACTGGAATTA
TR CPN60 F TTGACCGTGGTTATATCTCTCC A. baumannii cpn60 transcription
TR CPN60 R CGGATTTTCAAGTTCAGCAG

a Used in combination to amplify the blaOXA-143 allele.

bused in combination with OXA SET B R and with OXA-23 R primers.

Fonseca et al.

Fonseca et al. BMC Microbiology 2013 13:245   doi:10.1186/1471-2180-13-245

Open Data