Table 1

The genes analyzed in this study and the sequences of the qPCR primer sets
Gene Official symbol Product Primers
Abcg5 Abcg5 ATP-binding cassette, sub-family G (WHITE), member 5 TGTCAACAGTATAGTGGCTCTG
CGTAAAACTCATTGACCACGAG
Abcg8 Abcg8 ATP-binding cassette, sub-family G (WHITE), member 8 CTTGTCCTCGCTATAGCAACC
TTTCCACAGAAAGTCATCAAAGC
Asbt Slc10a2 Apical sodium-dependent bile acid transporter ACCTTCCCACTCATCTATACTG
CAAATGATGGCCTGGAGTCC
Bsep Abcb11 Bile salt export pump CAACGCATTGCTATTGCTCGG
TAGACAAGCGATGAGCAATGAC
Cyp7a1 Cyp7a1 Cholesterol 7 alpha hydroxylase GGGAATGCCATTTACTTGGATC
TATAGGAACCATCCTCAAGGTG
Fabp6 Fabp6 Fatty acid binding protein 6 GAATTACGATGAGTTCATGAAGC
TTGCCAATGGTGAACTTGTTGC
Fgf15 Fgf15 Fibroblast growth factor 15 AGACGATTGCCATCAAGGACG
GTACTGGTTGTAGCCTAAACAG
FgfR4 Fgfr4 Fibroblast growth factor receptor 4 CTCGATCCGCTTTGGGAATTC
CAGGTCTGCCAAATCCTTGTC
FXR Nr1h4 Farnesoid X receptor (nuclear receptor subfamily 1, group H, member 4) GTTCGGCGGAGATTTTCAATAAG
AGTCATTTTGAGTTCTCCAACAC
βKlotho Klb Beta Klotho AACAGCTGTCTACACTGTGGG
ATGGAGTGCTGGCAGTTGATC
Mdr1a Abcb1a ATP-binding cassette, sub-family B member 1a CCGATAAAAGAGCCATGTTTGC
CTTCTGCCTGATCTTGTGTATC
Mdr1b Abcb1b ATP-binding cassette sub-family B member 1b GGACCCAACAGTACTCTGATC
ACTTCTGCCTAATCTTGTGTATC
Mdr2 Abcb4 Multidrug resistance protein 2 TTGTCAATGCTAAATCCAGGAAG
AGTTCAGTGGTGCCCTTGATG
Mrp2 Abcc2 ATP-binding cassette, sub-family C (CFTR/MRP) member 2 GGCTCATCTCAAATCCTTTGTG
TTTTGGATTTTCGAAGCACGGC
Mrp3 Abcc3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 GAACACGTTCGTGAGCAGCC
ATCCGTCTCCAAGTCAATGGC
Mrp4 Abcc4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 TACAAGATGGTTCAGCAACTGG
GTCCATTGGAGGTGTTCATAAC
Ntcp Slc10a1 Sodium-taurocholate co-transporting polypeptide CGTCATGACACCACACTTACTG
GATGGTAGAACAGAGTTGGACG
Osta Osta Organic solute transporter alpha TCTCCATCTTGGCTAACAGTG
GATAGTACATTCGTGTCAGCAC
Ostb Ostb Organic solute transporter beta CCACAGTGCAGAGAAAGCTGC
ACATGCTTGTCATGACCACCAG
Shp Nr0b2 Small heterodimer partner AGTCTTTCTGGAGCCTTGAGC
TTGCAGGTGTGCGATGTGGC
SrbI Scarb1 Scavenger receptor class B type 1 GAACTGTTCTGTGAAGATGCAG
GCGTGTAGAACGTGCTCAGG
36B4 Rplp0 Ribosomal protein, large, P0 TCTGGAGGGTGTCCGCAAC
CTTGACCTTTTCAGTAAGTGG

The top sequence of each set corresponds to the forward primer and the bottom one to the reverse. All reactions were done in 10 μl final volume with 40 cycles of 30 seconds denaturing at 95°C, 30 seconds annealing at 60°C and 30 seconds extension at 72°C (except annealing temperature for Ostβ, which was 62°C).

Romain et al.

Romain et al. BMC Microbiology 2013 13:238   doi:10.1186/1471-2180-13-238

Open Data