Table 2

Primers used in the study
Target/Specificity Primer/Probe Sequence (5’ → 3’) Annealing Temperature (°C) Reference
LactobacillusPediococcus-Leuconostoc-Weissella (Lactobacillus group) (341 bp) Lac1: AGC AGT AGG GAA TCT TCC A 62 [39,40]
Lab667r: CAC CGC TAC ACA TGG AG
Enterococcus spp.(144 bp) Ent-F: CCC TTA TTG TTA GTT GCC ATC ATT 60 [41]
Ent-R: ACT CGT TGT ACT TCC CAT TGT
Enterobacteriaceae (195 bp) Enterobac-F: CAT TGA CGT TAC CCG CAG AAG AAG C 63 [42]
Enterobac-R: CTC TAC GAG ACT CAA GCT TGC
Staphylococcus spp. (370 bp) TStaG422: GGC CGT GTT GAA CGT GGT CAA ATC 55 [43]
TStaG765: TIA CCA TTT CAG TAC CTT CTG GTA A
Bacillus spp. (995 bp) BacF: GGGAAACCGGGGCTAATACCGGAT 55 [44]
BacR: GTC ACC TTA GAG TGC CC
E. coli (544 bp) ECP79F: GAA GCT TGC TTC TTT GCT 54 [45]
ECP620R: GAG CCC GGG GAT TTC ACA T
†SLT-I (614 bp) VT1 (SLTI-F): ACA CTG GAT GAT CTC AGT GG 55 [44]
VT2 (SLTI-R): CTG AAT CCC CCT CCA TTA TG
†SLT-II (779 bp) VT3 (SLTII-F): CCA TGA CAA CGG ACA GCA GTT 55
VT4 (SLTII-R): CCT GTC AAC TGA GCA CTT T
16S rDNA Sequencing 616V: AGA GTT TGA TYM TGG CTC 52 [46]
(~1500 bp) 630R: AAG GAG GTG GAT CCA RCC
CAKAAAGGAGGTGGATCC
Random Primer for RAPD DAF4: CGG CAG CGC C 35 [47]
M13V: GTT TTC CCA GTC ACG ACG TTG 35 [48]
Universal Primers HDA1: ACT CCT ACG GGA GGC AGC AG 52 [49]
HDA2: GTA TTA CCG CGG CTG CTG GCA
HDA1 + GC: CGC CCG GGG CGC GCC CCG GGC GGG GCG GGG GGC ACG GGG GGA CTC CTA CGG GAG GCA GCA G
TA Cloning M13Forward (−20): GTA AAA CGA CGG CCA G 55 [50]
M13Reverse: CAG GAA ACA GCT ATG AC
†Pediocin Structural Gene pedA (100 bp) pedA2RTF: GGC CAA TAT CAT TGG TGG TA 60 [25]
pedA2RTR: ATT GAT TAT GCA AGT GGT AGC C
TqM-pedA: FAM-ACT TGT GGC AAA CAT TCC TGC
TCT GTT GA-TAMRA
†Total Bacteria (727 bp) TotalBac-F785: GGA TTA GAT ACC CTG GTA GTC 52 [51-53]
TotalBac-R1512r: TAC CTT GTT ACG ACT T
TaqMan 1400r Probe: 6-FAM-TGA CGG GCG GTG TGT ACA AGG C-TAMRA

All dagger-marked primer pairs were used in the preparation of standards and qPCR analyses.

Wang et al.

Wang et al. BMC Microbiology 2013 13:19   doi:10.1186/1471-2180-13-19

Open Data