Table 3

Compilation of primers used for the amplification of ITS, EF-1a, ß-tubulin, RPB2, BotF15 of the fungus, and of partial 16S rDNA region of the bacteria
Forward primer 5′ – 3′ Reverse primer 5′ – 3′ Literature
ITS ITS1: TCCGTAGGTGAACCTGCGG ITS4: TCCTCCGCTTATTGATATGC White et al. 1990 [15]
EF-1a EF-AF: CATCGAGAAGTTCGAGAAGG EF-BR: CRAT GGT GAT ACC RCG CTC Pavlic et al. 2009 [18]
ß-tubulin Bt2a: GGTAACCAAATCGGTGCTGCTTTC Bt2b: ACCCTCAGTGTAGTGACCCTTGGC Pavlic et al. 2009 [18]
RPB2 RPB2bot6F: GGTAGCGACGTCACTCCC RPB2bot7R: GGATGGATCTCGCAATGCG Pavlic et al. 2009 [18]
BotF15 Bot15: CTGACTTGTGACGCCGGCTC Bot16: CAACCTGCTCAGCAAGCGAC Pavlic et al. 2009 [18]
16S rDNA 27 F: AGAGTTTGATGCTCAG 765R: CTGTTTGCTCCCCACGGTTTC Coombs and Franco 2003 [33]

Dalmas et al.

Dalmas et al. BMC Microbiology 2013 13:168   doi:10.1186/1471-2180-13-168

Open Data