Table 1

Proteins found to be differentially regulated by σH, as determined by a proteomic comparison between L. monocytogenes 10403S ΔBCL and ΔBCHL
Proteina Fold change Δ BCL BCHL Description Gene name Role categoryb Sub-Role categoryb Promoterd Sigma factor
Proteins with positive fold change (> 1.5) and p < 0.05 (indicating positive regulation by σH)
Lmo0027 1.55 beta-glucoside-specificPTS system IIABC component lmo0027 Transport and binding proteins Carbohydrates, organic alcohols, and acids
    aggaca
cgtgtatgcgtggagtcctc
    gaatga
SigmaH
Amino acid biosynthesis Aromatic amino acid family
Energy metabolism Pyruvate dehydrogenase
Lmo0096 3.39 mannose-specific PTS system IIAB component ManL mptA Energy metabolism Pyruvate dehydrogenase
    tggca
cagaac
    ttgca
SigmaL
Amino acid biosynthesis Aromatic amino acid family
Transport and binding proteins Carbohydrates, organic alcohols, and acids
Lmo0239 1.82 cysteinyl-tRNA synthetase cysS Protein synthesis tRNA aminoacylation
    ttgcaa
ggaattttattgctgtta
    taatag
SigmaA
Lmo0319 1.77 beta-glucosidase bglA Energy metabolism Sugars N/A N/A
Lmo0356 2.16 YhhX family oxidoreductase lmo0356 Energy metabolism Fermentation
    tggcta
agtacagcgctagtgtag
    tactat
SigmaA
Energy metabolism Electron transport
Central intermediary metabolism Other
Lmo1001 1.65 hypothetical protein lmo1001 Unclassified Role category not yet assigned N/A N/A
Lmo1070 2.18 similar to B. subtilis YlaN protein lmo1070 Hypothetical proteins Conserved
    ttgcgt
ggcaaataaattatgc
    tatact
SigmaA
Lmo1255 1.60 trehalose-specific PTS system IIBC component lmo1255 Energy metabolism Pyruvate dehydrogenase
    ttgcgc
tttcaactgatttatag
    tatagt
SigmaA
Amino acid biosynthesis Aromatic amino acid family
Transport and binding proteins Carbohydrates, organic alcohols, and acids
Lmo1439 1.66 superoxide dismutase sodA Cellular processes Detoxification
    ttgcaa
gcatttagggagcatgg
    taggct
SigmaA
    gttt
aacttttgagtttca
    gggaaa
SigmaB
Lmo1454c 1.85 RNA polymerase sigma factor RpoD rpoD Transcription Transcription factors
    gtttt
aaaaccgctaaatga
    tggtat
SigmaB
    aggact
tttgctttttgtggc
    gaatat
SigmaH
    ttgact
ttttagcaaaaatacag
    tatctt
SigmaA
Lmo2006 1.60 acetolactate synthase catabolic alsS Amino acid biosynthesis Aspartate family
    ttgcaa
taattcttttgagtag
    tataat
SigmaA
Amino acid biosynthesis Pyruvate family
Lmo2064 2.01 large conductance mechanosensitive channel protein mscL Cellular processes Adaptations to atypical conditions
    tttcac
atcgcagttagatgttt
    tatact
SigmaA
Lmo2487 1.65 hypothetical protein lmo2487 Hypothetical proteins Conserved N/A N/A
Lmo2614 2.05 50S ribosomal protein L30 rpmD Protein synthesis Ribosomal proteins: synthesis and modification
    ttgatt
actacccctaacccgtg
    tataat
SigmaA
Lmo2621 1.63 50S ribosomal protein L24 rplX Protein synthesis Ribosomal proteins: synthesis and modification
    ttgatt
actacccctaacccgtg
    tataat
SigmaA
Proteins with negative fold change (< -1.5) and p < 0.05 (indicating negative regulation by σH)
Lmo1877 −1.61 formate-tetrahydrofolate ligase fhs Amino acid biosynthesis Aspartate family
Protein synthesis tRNA aminoacylation
Amino acid biosynthesis Histidine family
Purines, pyrimidines, nucleosides, and nucleotides Purine ribonucleotide biosynthesis
Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A
Lmo2094 −7.35 hypothetical protein lmo2094 Energy metabolism Sugars
Lmo2097 −3.17 galactitol-specific PTS system IIB component lmo2097 Energy metabolism Pyruvate dehydrogenase
Amino acid biosynthesis Aromatic amino acid family
Transport and binding proteins Carbohydrates, organic alcohols, and acids
Lmo2098 −2.33 galactitol-specific PTS system IIA component lmo2098 Energy metabolism Pyruvate dehydrogenase
Amino acid biosynthesis Aromatic amino acid family
Transport and binding proteins Carbohydrates, organic alcohols, and acids

aProtein names are based on the L. monocytogenes EGD-e locus.

bRole Categories and Sub-Role categories are based on JCVI classification [26].

cReported as positively and directly regulated by σH in Chaturongakul et al., 2011 [7].

dPromoters were identified based on RNA-Seq data (Orsi et al., unpublished) or previously published data. -10 and -35 (σA, σB, σH) and -12 and -24 (σL) regions are underlined. N/A indicates that a promoter was not identified.

Mujahid et al.

Mujahid et al. BMC Microbiology 2013 13:156   doi:10.1186/1471-2180-13-156

Open Data