Table 1

The mutation primers used to generate all the mutants
Mutants Template Mutation primers
M1 (RhoAΔ1-10) pECFP-RhoA WT (1-10aa deleted) forward: 5’-GTCGACGATTTCGACGTTGGTGATGGAGCC-3’
reverse: 5’-GGCTCCATCACCAACGTCGAAATCGTCGAC-3’,
M2 (RhoAΔ11-20) pECFP-RhoA WT (11-20aa deleted) Forward: 5’-CGGAAGAAACTGGTGATTTTGCTCATAGTTAACAGC-3’
Reverse: 5’- GCTGTTAACTATGAGCAAAATCACCAGTTTCTTCCG-3’
M3 (RhoAΔ21-30) pECFP-RhoA WT (21-30aa deleted) Forward: 5’-CTGTGGAAAGACATGCCCAGAGGTGTATGTGC-3’
Reverse: 5’- GCACATACACCTCTGGGCATGTCTTTCCACAG-3’
M4 (RhoAΔ31-40) pECFP-RhoA WT (31-40aa deleted) Forward: 5’- GCGAGGACCAGTTCAACTATGTGGCAG-3’
Reverse: 5’- CTGCCACATAGTTGAACTGGTCCTCGC-3’
M5 (RhoAΔ41-50) pECFP-RhoA WT (41-50aa deleted) Forward: 5’-GCCCACAGTGTTTGAGAAGCAGGTAGAGTTGG-3’
Reverse: 5’- CCAACTCTACCTGCTTCTCAAACACTGTGGGC-3’
M6 (RhoAΔ51-60) pECFP-RhoA WT (51-60aa deleted) Mutant 6 Forward: 5’-CGAGGTGGATGGAGCTGGGCTGGAAG-3’
Mutant 6 Reverse: 5’- CTTCCAGCCCAGCTCCATCCACCTCG -3’
M7 (RhoAΔ61-70) pECFP-RhoA WT (61-70aa deleted) Forward: 5’-CTTTGTGGGACACACCCCTCTCCTACCC-3’
Reverse: 5’-GGGTAGGAGAGGGGTGTGTCCCACAAAG-3’
M8 (RhoAΔ71-80) pECFP-RhoA WT (71-80aa deleted) Forward: 5’-GATTATGATCGCCTGAGGCTGATGTGTTTTTCCATC-3’
Reverse: 5’- GATGGAAAAACACATCAGCCTCAGGCGATCATAATC-3’
M9 (RhoAΔ81-90) pECFP-RhoA WT (81-90aa deleted) Forward: 5’-CCCAGATACCGATGTTATAAGTTTAGAAAACATCCCAG-3’
Reverse: 5’-CTGGGATGTTTTCTAAACTTATAACATCGGTATCTGGG-3’
M10 (RhoAΔ91-100) pECFP-RhoA WT (91-100aa deleted) Forward: 5’-CGACAGCCCTGATCCAGAAGTCAAGC-3’
Reverse: 5’- GCTTGACTTCTGGATCAGGGCTGTCG-3’
M11 (RhoAΔ101-110) pECFP-RhoA WT (101-110aa deleted) Forward: 5’-CAGAAAAGTGGACCCCCATCATCCTGG-3’
Reverse: 5’-CCAGGATGATGGGGGTCCACTTTTCTG-3’
M12 (RhoAΔ111-120) pECFP-RhoA WT (111-120aa deleted) Forward: 5’-CTGTCCCAACGTGCTTCGGAATGATG-3’
Reverse: 5’- CATCATTCCGAAGCACGTTGGGACAG-3’
M13 (RhoAΔ121-130) pECFP-RhoA WT (121-130aa deleted) Forward: 5’-GTTGGGAATAAGAAGGATCTAGCCAAGATGAAGCAG-3’
Reverse: 5’-CTGCTTCATCTTGGCTAGATCCTTCTTATTCCCAAC-3’
M14 (RhoAΔ131-140) pECFP-RhoA WT (131-140aa deleted) Forward: 5’-CACACAAGGCGGGAGCCTGAAGAAGGCAG-3’
Reverse: 5’-CTGCCTTCTTCAGGCTCCCGCCTTGTGTG-3
M15 (RhoAΔ141-150) pECFP-RhoA WT (141-150aa deleted) Forward: 5’-GGAGCCGGTGAAAATTGGCGCTTTTG-3’
Reverse: 5’- CAAAAGCGCCAATTTTCACCGGCTCC-3’
M16 (RhoAΔ151-160) pECFP-RhoA WT (151-160aa deleted) Forward: 5’-GAGATATGGCAAACAGGGCAAAGACCAAAGATGG-3’
Reverse: 5’- CCATCTTTGGTCTTTGCCCTGTTTGCCATATCTC-3’
M17 (RhoAΔ161-170) pECFP-RhoA WT (161-170aa deleted) Forward: 5’-GTGCATGGAGTGTTCATTTGAAATGGCTACG-3’
Reverse: 5’- CGTAGCCATTTCAAATGAACACTCCATGCAC-3’
M18 (RhoAΔ171-180) pECFP-RhoA WT (171-180aa deleted) Forward: 5’-GGAGTGAGAGAGGTTGCTAGACGTGGGAAG-3’
Reverse: 5’- CTTCCCACGTCTAGCAACCTCTCTCACTCC-3’
M19 (RhoAΔ181-192) pECFP-RhoA WT (181-192aa deleted) Forward: 5’-GAGCTGCTCTGCAACTTGTCTTGCCGCG-3’
Reverse: 5’- CGCGGCAAGACAAGTTGCAGAGCAGCTC-3’

Na et al.

Na et al. BMC Microbiology 2013 13:125   doi:10.1186/1471-2180-13-125

Open Data